Transcript asmbl_11341

Sequence
Transcript Sequence for observation asmbl_11341 of TGE0003528:
TTTCCAAGTCCAGTGGGTCATTGTCACATAAATGCTTCATCTCTGGTAGGCTAAAAGTCGCTAAATATTTGCATGTTCCGTGTGTGACCCTGCTTGCCTCCACATGCCTAGCACTTAGCTTAGAAGGTACTGTCTATTTCGAGCTATTTTAATTCACTTTGATGAAATACGGGTGAGCCCGAGCGCACGCAGGCCCGGGGTTCGCAGACCTCAGCAGTGAGATGGTGACTCGTTTCCAGACATCTACGTCTGCATGATCTCCTCTGCACACAACGTGGCAGCGCAGGGCAAGTACATCGCCATCGTCAGCACCACCGTGGAGACCAAGGAGCCCGAGAAGGAGATCAGACCCGCTCTGGAGCTCTTGGAACCAATTGAGCAGAAATTCGTTAGCATCAGTGACCTGCTCGTACCAAAGGATTTGGGAACAGAGAGCCAGATCTTTATTTCCCGTGCCTATGATGCCACAACTCACTTTGAGACGACCTGTGATGACATTAAGGACATCTATAAGAGAATGACAGGATCAGAGTTTGACTTTGAGGAAATGAAGCGCAAGAAAAATGACATCTATGGGGAAGACTAACAGCGATACATGTTATCTAATTAGGACAAACTTAAAATTTGGCAAATGATTCGTAATGTATGAAATCCATATCGTGAGGCCTGCTTTTGTAACCACAGCGGAGGGCTGCAGAGCACTGCACCAGTCAGTATTCCTCCCCTTTCCGACATCATGTATTAACTCGTTTTCCTGGAGTGGCTATTCAGAATTGGCAGGTGACCACACTCTGTACAGTTTAAGCGATGCTGGCTTTTTTTTCTAGTGATGGATAAATTT