Transcript asmbl_11309

Sequence
Transcript Sequence for observation asmbl_11309 of TGE0003509:
GATTGGCGTCTCTCCCTCATTATGCTGGGCTGGGGAGAAAGGCGAATGGCCTAGTGGTCAGCAGCATGGATTGCAAGCCAGACCACCTGGGTTCAGATCTTAGCTCTGACAGCTCTGTGACCTTGGATGTCCAGCTCGCCGCTGTCCAAGAAACGTCGCGTGTCCGGGCCTGATCCAAAGCCGGGTTCTAACTGTTCCCCCGCCCAGTCTGTGTTGTCCGAAGTGCCCTCGGTGCCAACTAACGGAATGGCGAAGAACGGCAGTGAAGCAGACATAGATGAGGGCCTTTACTCTCGGCAGCTGTACGTGTTGGGCCATGAGGCAATGAAGCGGCTCCAGACATCCAGCGTACTGGTATCAGGCCTGCGGGGCCTGGGCGTGGAGATTGCCAAAAACATCATCCTTGGTGGGGTCAAGGCTGTCACCCTACATGACCAGGGCACTGCCCAGTGGGCTGACCTCTCTTCCCAGTTCTACCTGCGGGAGGAGGACATTGGTAAAAACCGGGCAGAGGTCTCCCAGCCCCGTCTTGCTGAACTCAACAGCTACGTGCCTGTCAGCGCCTACACTGGGCCTCTTGTCGAGGACTTCCTTAGTGGCTTCCAGGTGGTGGTCCTCACCAACACCCCCCTGGAGGACCAGCTTCGGGTGGGTGAGTTCTGTCACAGCCGTGGCATCAAGCTGGTGGTGGCAGACACACGGGGCCTATTTGGACAACTCTTCTGTGACTTCGGAGAAGAAATGATTCTCACTGATTCCAATGGAGAGCAGCCACTCAGTGCTATGGTTTCTATGGTCACCAAGGACAACCCCGGTGTGGTTACCTGCCTGGATGAGGCCCGACATGGGTTTGAGAATGGCGACTTTGTCTCCTTCTCAGAAGTACAGGGCATGGTTGAACTCAACGGAAGTCAGCCCATGGAGATCAAAGTTCTGGGTCCTTACACCTTTAGCATCTGTGACACCTCTCACTTCTCTGACTATATCCGTGGTGGTATCGTCAGTCAGGTCAAAGTACCTAAGAAGATCAGCTTTAAATCTTTGCTGGCCTCACTGGCAGAGCCCAACTTCGTGATGACAGACTTTGCCAAGTTTTCCCGTCCTGCACAGCTGCACATTGGCTTCCAGGCCCTGCACCAGTTCTGTGCTCAGCACGGCCGGGCCCCTCGGCCCCGCAATGAGGAGGATGCAACAGAGCTAGTGACCTTAGCCCAGGCCATGAATGCTCGAGCCCTGCCAGCAGTGCAGCAGGACAGTCTGGATGAGGACCTCATCCGGAAGCTGGCATATGTGGCTGCTGGGGATCTGGCACCCATAAACGCCTTCATTGGGGGCCTGGCTGCCCAGGAGGTCATGAAGGCCTGCTCTGGGAAGTTTATGCCTATCATGCAGTGGCTATACTTTGATGCTCTGGAGTGTCTCCCTGAGAACAAAGAGGCCCTCACAGAGGACAAGTGCCTCCCGCGCCAGAACCGTTACGATGGGCAGGTGGCTGTATTTGGCTCAGACCTACAAGAGAAGCTGGGCAAGCAGAAATACTTCCTGGTGGGTGCAGGAGCCATTGGCTGTGAGCTGCTCAAGAACTTTGCAATGATTGGATTGGGCTGTGGAGAAGGCGGAGAAATTGTCGTCACAGACATGGACACCATTGAGAAGTCAAATCTGAACCGACAGTTTCTCTTCCGGCCCTGGGATGTTACGAAGTTAAAGTCTGACACCGCTGCTGCAGCTGTGCACCAGATGAATCCACACATCCAGGTGACAAGCCACCAGAACCGTGTGGGCCCTGACACAGAGCGCATCTATGACGATGAGTTCTTCCAAAACTTGGACGGTGTGGCCAATGCCCTGGACAATGTGGATGCTCGCATGTACATGGACCGCCGCTGCGTGTACTACCGTAAGCCGCTGCTAGAGTCAGGCACACTGGGCACCAAGGGCAACGTGCAGGTGGTGATCCCCTTCCTGACAGAGTCGTACAGCTCTAGCCAGGACCCGCCTGAGAAGTCCATCCCTATCTGCACGCTGAAGAACTTCCCCAACGCTATCGAGCACACCCTGCAGTGGGCTCGGGATGAGTTTGAAGGCCTTTTCAAGCAGCCAGCAGAAAACGTCAACCAGTACCTCACAGACCCCAAGTTTGTGGAGCGGACCCTGCGGCTGGCGGGCACCCAACCTCTGGAGGTGCTGGAGGCCGTGCAGCGCAGCCTGGTGCTGCAGCGGCCACAGACCTGGGCTGACTGTGTGACCTGGGCTTGTCACCACTGGCACACTCAGTACTCTAACAACATCCGGCAGCTGCTGCACAACTTCCCTCCTGACCAGCTCACGAGCTCAGGAGCTCCGTTTTGGTCTGGGCCCAAACGCTGTCCGCATCCGCTCACCTTTGATGTCAGCAATCCCCTGCATCTGGACTACGTGATGGCTGCCGCTAACCTGTTTGCCCAAACCTACGGGCTGACGGGCTCTCAGGACCGAGCTGCGGTGGCCGCCCTCCTACAGGCTGTTCAGGTCCCCGAGTTCACCCCTAAGTCTGGCGTCAAGATCCACGTCTCTGACCAGGAGCTGCAGAGTGCCAATGCCTCTGTTGATGACAGCCGTCTAGAGGAGCTCAAGGCCACACTGCCTAGTCCAGAAAAGCTCCCTGGATTCAAGATGTACCCCATCGACTTTGAGAAGGATGATGACAGCAACTTCCATATGGATTTCATTGTGGCTGCATCCAACCTTCGGGCAGAGAACTATGACATTCCCCCTGCAGACCGGCACAAGAGCAAGCTGATTGCAGGGAAGATCATCCCAGCCATAGCCACAAGCACAGCAGCTGTGGTTGGCCTTGTGTGTCTGGAGCTCTACAAGGTGGTGCAGGGACACCGACGGCTTGACTCCTACAAGAATGGTTTCCTCAACTTAGCCCTACCCTTTTTCGGCTTCTCTGAACCCCTTGCCGCACCCCGTCACCAGTACTATAACCAAGAGTGGACGTTGTGGGATCGCTTTGAGGTACAGGGGCTGCAGCCTAACGGTGAGGAGATGACCCTCAAACAGTTCCTTGACTACTTTAAGACAGAGCATAAATTGGAGATCACCATGCTGTCCCAGGGTGTGTCCATGCTTTACTCCTTTTTCATGCCAGCTGCCAAGCTCAAGGAACGATTGGATCAGCCGATGACAGAGATCGTAAGCCGTGTGTCGAAGCGAAAGCTGGGCCGCCATGTGCGGGCGCTGGTGCTTGAGCTGTGCTGCAACGACGAGAGCGGCGAGGACGTCGAGGTCCCCTACGTACGATACACCATCCGCTGACCCCCAGCCCCTCCTGTAGACTGGCCCCAGGCCCCCTCTCCAAACCCCTTCCAGCCCAGGGCTCCCAGTTGACCTCTGGCAGTGGCCCAGCTAGCCAAGCCTGGTGTTCCCTCTTCATCCCCCTACTTGAACCCCTCTTGCCGCTGCTTCCTACCTTGTTCAGAACCTGAATCCTAATAAAGAGTTATTAACCCA