Transcript asmbl_10580

Sequence
Transcript Sequence for observation asmbl_10580 of TGE0007905:
AGCAACAGCAGCAGCAGCAGCAGCCTCGCCCTCCTCCTCGCCAGCAGGAAAGAGCCCACTTGGAGAGTCTGGGGCTCAGTAGGCCTAGTCCCCAGCTGTTGGCAGAAACCCCTGTGCCTGGCCTCCCTGAGTTCCCACGGGCAGCCTCCCAGCAGGAGATCGAGCAGTCCATCGAAACCCTCAACATGCTGATGCTGGACCTGGAGCCAGCTGCGGCTGCCGCCCCCCTGCACAAATCCCAGAGTGTCCCAGGGGCCTGGCCAGGGGCCTCCCCGCTCTCTTCCCAGCCCTTCTCCGGCTCCTCCTGCCAGTCCCATCCGCTGACCCAGTCCAGATCTGGCTACATCCCCAGTGGGCATTCCTTGGGAACCCCTGAGCCAGCTCCACAGGCCTCCCTGGAGTCCGTCCCTCCTGGCAGGCCTTACTCACCTTATGATTATCAGCCATGTCCGGCTGGGCCCAACCAGAGCTACCGTCCAAAGAGCCCAGCTTCCTCCTCCACGTCCTCTGCCTTCCTTCCAACCACTCACAGCCCTTCAGGGCCTCAGCAGCCTCCGGCATCTCTCCCTGGCCTCACCGCTCAGCCTCAGCTCTCACCAAAGGAAGCGACTTCAGATCCATCCCGAACTCCGGAGGAGGAACCCTTGAACTTGGAGGGGCTAGTGGCCCACCGGGTAGCAGGGGTGCAGGCTCGGGAGAAGCAGCCTGCAGAGCCCCCGGCCCCTCTCCGGAGGCGGGCGGCCAGTGATGGACAGTATGAGAACCAGTCTTCAGAACCCTCATCTCCCCGGAGCCCTGGGGTTCGCTCCCCTGTCCAGTGCGTCTCCCCAGAGCTGGCTCTCACCATCGCTCTTAATCCTGGAGGACGGCCCAAAGAGCCCCATCTGCACAGCTACAAGGAGGCTTTTGAGGAGATGGAGGGAACCTCTCCGACCAGCCCACCGCCCAGTGGGGTGCGCTCCCCTCCAGGTCTGGCCAAGACACCCCTGTCTGCTCTGGGCCTGAAACCCCACAACCCAGCGGACATCCTGTTGCACCCCACAGGTGAGCCTCGGAGCTACGTCGAGTCGGTGGTGCGGACGGCAGTAGCTGGGCCCCGAGCTCAGGACCCTGAGCCCAAGAGCTTTAGCGCCCCAGCTGCCCAGGCCTATGGCCATGAGACGCCCCTGAGGAATGGGACCCTGGGTGGCTCCTTTGTCTCCCCCAGCCCCCTCTCCACCAGCAGCCCCATCCTCAGCGCTGACAGCACTTCAGTGGGGAGTTTCCCGTCAGGAGAGAGCAGTGACCAGGGCCCCCGGACACCCACCCAGCCTTTGCTGGATTCCGGCTTCCGCTCCGGCAGCCTGAGCCAGCCCAGCCCTTCGGCTCAGAGAAGCTACCAGAGTTCTTCTCCTCTCCCGGCCGTGGGCAGCAGCTACAGCAGCCACGACTACTCACTGCAGCAGTTCAACTCCCCAGAAAGCCAGGCCCGGGCTCAGTTTGCTGTGCCCAGCGTCCACACGGTACCCGGGAGCCCTCAGGCACGCCAGAGGACAGTGGGCACCAATACTCCCCCTAGCCCTGGCTTTGGTCGCCGAGCCATCAACCCCAGCATGGCTGCCCCTGGCAGCCCCAGTTTGAGCCACCGCCAGGTGATGGGCCCATCAGGAGCTGGTTTCCATGGTAACACAGTTTCCAGCCCCCAGAGCAGTGCAGCGACCACTCCAGGAAGCCCCAGCCGGGGCCAGCACCCTGGGGCCCACCAGGCCTCAGGCCTCCATGGCAGTGTGGTCACCACTCCAGGGAGCCCAAGCCTGGGCCGGCACCCAGGAACCCACCAGGGCAACCTGGCCCCCAGTCTCCATGGCAACACAATAGCCAGCCCCGGAAGCCCCAGCCTGGGCCGGCACCTGGGAGGATCTGGATCTGTGGTTCCCGGAAGCCCCAGCTTAGACCGGCACGTGGCCTATGGCGGCTACTCCACCCCTGAGGACCGGAGACCCACGCTGTCCCGGCAGAGCAGTGCCTCCGGCTACCAGGCTCCCTCCACGCCCTCCTTCCCTGTGTCCTCTGCCTACTACCCTGGTCTGAGTAGCCCTGCCACCTCCCCCTCGCCGGATTCAGCAGCCTTCCGGCAAGGGAGCCCAACACCGGCCTTGCCAGAGAAGCGGAGGATGTCCATGGGAGACCGGGCGGGCAGCCTCCCCAACTATGCTACCATCAACGGGAAGGTGTCCTCCTCGCCTGTCGCCAGCGGCATGTCCAGTCCCAGTGGGAGCAGCACCGTCTCCTTCTCTCATACTCTGCCTGACTTCTCCAAGTACTCCATGCCAGACAACAGCCCTGAGACCCGGGCTAAAGTGAAATTTGTCCAGGACACTTCCAAGTATTGGTACAAGCCTGAGATCTCTAGAGAGCAGGCCATCGCACTCCTGAAGGACCAGGAACCAGGGGCCTTCATCATCCGTGACAGTCACTCCTTCCGAGGGGCCTATGGGCTGGCCATGAAGGTGTCATCTCCCCCTCCGACCATTATGCAGCAGAATAAAAAAGGGGACATGACCCATGAGCTGGTGAGACATTTCCTGATAGAGACTGGCCCTAGAGGAGTCAAGCTCAAGGGGTGCCCCAATGAGCCAAACTTTGGATCCCTCTCTGCCCTGGTCTACCAGCACTCCATCATCCCACTGGCTCTGCCCTGCAAGCTGGTCATTCCAAACCGAGATCCCACAGATGAATCGAAAGATAGCTCAGGCCCTGCCAACTCAACCACTGACCTGTTGAAGCAAGGGGCAGCCTGTAACGTGCTCTTCGTCAACTCTGTGGATATGGAGTCACTCACTGGGCCACAGGCCATCTCCAAAGCCACTTCTGAGACACTGGCTGCTGACCCCACGCCGGCTGCCACCATTGTTCACTTCAAAGTTTCTGCCCAGGGAATTACACTGACTGACAACCAGAGGAAGCTCTTCTTCAGACGACACTACCCCCTCAACACTGTCACTTTCTGTGACCTGGATCCACAGGAGAGAAAGTGGATGAAGACGGAGGGAGGGGCCCCTGCTAAGCTCTTCGGCTTTGTGGCCCGGAAGCAGGGCAGCACCACGGACAACGCCTGCCACCTCTTCGCTGAGCTTGACCCTAACCAGCCTGCTTCCGCCATTGTCAACTTTGTCTCCAAGGTCATGCTGAGTGCTGGCCAGAAGAGATGAACCCACCCCTTGCCTGGGGCCAGGGCAGTGGGGATGGGGCATGTGGGGGCGGGGAGACCCATGAATCCTGACCACCTTTAAATCCAGAAGGAGGACTTTGGGCTAATTTTGGAGAAGGAGAGAAGAAAGTGCAATGTGGGGAGAGGGAAGTGAATCGCAGAGGGGAGGGGGAGAGCGGGAGAGAAAGAAAGAAAAAGATGGAGGAGGATTACTGGGATTCCTTTGGTTAGATGGATACTACGTAACCCCAAAGCCTCCCAAACTAACCAGGTCCACCTAACTCTCCCTCACCCTCCCAGAAGACAGAGTTTCTCAAAGGAGGCAGAACGGACCTCCTTGGGGATCCATGTTTTGAGGGGAATGGAAAAGCTCTGTCTCCCTAGCCCTGCTTTGCAAGGAGAAATCAAGTTGAGAGAATCTTTTTCCGGCGATCTCTAGGGTAGATTGCCAAACCAAAAAGAGCCAGCATGGGACGTCAAGGGGCAGGACTTTTGTTTTTGAAGGTAACTCAGACCCGAGGCACCTAAGGTCTCTTTGCTCTGTCTCCGATGTATAGTTCATGTGGGTATATATGTAGGGTGTGTATATGTCCACACCCACATCCTCACACACTGATTTATATTTGCCTCTCAGCTCGCATTATAAACAGGTGTACTTGTCCGTGTCCATGCGTTTGCACACACGTGCATATCGTCCAAAGAAGGTTAGAGTTGGGGTGACACAGCAGAGGAAGGGGACATCAGCCCTTCTCCCCAGGAGCACCCAGGAATATGGGTAACAGACTCTGTCTCGGTCCCTGCACCTGCAGCCTAGTAGCCCTGGGTGCCAGCAGGAGCGGGGCCGGCCACCTGCAGCATCCCTGTTCTGCCTTGGCCAGGAGGCAGGAGCACTGATGTGAGGAGATGGGGGACACGAATGCCCATCGCCTTGGGGAAGAGATCCGTCAGCCGTGGTGGCTGCAGAGCTCCGGGCATCTCTCCTGAGGCGTGTGGCCCAGCGGTGAGGTGGCTGGGTCGCTCCTGCCAGTCCCAGGCCTCAGCCCGTCCTTGGGTGCCCCGCCCAGACCAGCCTTATCTCAGACTTGCTTATCTGCATGGTGTCTTATTGGGTGCTGGAGATTGAGCCTTCCTGCTCTGCCCTGCCCTGCTCTGTCCTGCAGGGTCCCCGTGTTGGGCTCATCCAGGGGATCCTGCTTCTAAGAGTCCTGCTCAGCGAGGCCCGGGGGAGACTCCTGTCGTCCTTGTACCCCCGTCTGCAAGTGTTTTGGGGCCCGACTTTTGCTGGGCTGTCCAGGTGACTTAGTAGAGCTCTGGGGGCTGCTACCTGTACACCACATGGCCTACCTACAATACCAAAGCCTTGCTGTTCCCCCTTCTGCCTTGGTTTCCCCAGCAGAGCCAAGCTGCTCGTGAGTGGAGGGCAGAAGGCACACATTTAGGCCAAAGGGCAGTTGGGAACCCCTCAACCTCCACCCAAGGACTCTAAGCTGGAATGGAAAGTCTACCAGGATTCCATTCTTGAGGGGTTTCTTAAGCCTCTGGGGGTCCCCTAGAGAGAGGCATTGTATTGATATATAAATATATATAATATATATGTGAGACATACTGACAGAATCTGTAAGCTAATAAAATATAAGAAAAGGTTAAAAAAAGAATAGGTAAATTGACAAGAAGTATTTATTATTTTCCCATATTGCTTTATTGCCTCCCTGGGCGTAAACCAATTCCCATCCCTCTTGATATGTTTAAGTGAAGCCTGAAATGTGGGGACCTTTTTCTTTGGAGCAATCAGGGGTCTCCTTGCCCTGGCCTTGACCTTCCCCAGACTCTGTCTGGGGCTCAGCGGGGAGGGGTGCACGTGTTCCACCCCCTTTGGCCCCCTTATTTTCTGGCAAGCCCAGGACTCAGCCATCAGCTCCCGAGATGAGAAGAGAGCTGTCTGCTTACTGCGGCTCCGGCCCCAGCGGGCCGGCGGGGGACATGCGTGTTTGTGGCTGGCTTGGGCAATGTGTGCATCTTTTGTATTTTTTTCTCCTCCGAGAAGCTGTGTCTGTGTGGGCCTTCTGTTTCAGGAGAGTGTCTATAGAGTGTCTAAAGTGGGGGCAGCCCCCACTTCCCAAAGATTGAAACCTTGTGCTTGGTGACCAGGCTCCTCCACAGTGCTCTTCCTTCTGAGGGCGTTCAAGCCAGATATCCGGAATTCCCTCTCCTCAGTCCCTCCTACCCCGACTCTCTTCCCAGGTGGGAGATATCCTGCCTCCTCCCTTTGTACATATCTTACCCTCCCACGGGACAGCCCGGGGACACTCTCCTGGTCTGGATGTCCTCGCCACACTTGAGGCCGGGTGGCGTGTGAGACCGTTCTGCGGACCCAGGCCTGGGGTCAGCCTTCTCACGTGCTTTCCCACTGCCCACCACGGCCCATCTCCCAGGC