Transcript asmbl_1033

Sequence
Transcript Sequence for observation asmbl_1033 of TGE0007816:
GGGAGCGGGATCTCGACTTCCGTATTTACCAATGGCTCCAAAACATACCTCACGTGCAACTTGAGTAGCAGCAACACTGAGATCGTCGGCCACCGCTGGATGAAAGGGGACAAGGTGCTGAAGGAGGATGAGCTGCCCGGCCTGAAAACGGAGTACGAGTTGGACACAGATGAGAGTGGGGGCCAGTACCTCTGTGTCTTCCTCCCGGAGGTCGTGGGCAAGGCCAGCATCAATGTGCCAGGACCCCCCAGAGTGAAGGCCGTGAAAAAGTCAGAGCACGCCACCGAGGGGGAGGGCGTCGTGCTGGCCTGCAAGTCTGAGTCCTTCCCCCCGATCACCGAGTGGGTGTGGTACAAGGTGAGTGACACCGAGCAGCAGGTCCTCACCAACAACTCCCAGAATAAGGTCTACGTGGTGTCCGTGGAGACCAGGACGGAGCTTCACATCCTGAACCTGAACTTGGAGACCGACCCCGGCAAGTACGTCTGCAACGGCAGCAGCGTGGAGGGCACCGACCAGGCCGTCATCGTCCTGCACGTTCGCAGCCAGCTCGCCGCCCTGTGGCCCTTCCTGGGCATTGTGGCCGAGGTGCTTGTGCTGGTCACCATCATCTTCATCTATGAGAAGCGGCGGAAGCCGGACGAGGTCCTGGATGACGAGGACACCGGCTCCGCGCCACTGAAGAGCAGTGGGCACCACGTGAACGACAAGGGCAAGAACGTCCGCCAGAGGAACTCCAGCTGAGCGTGTGAGTGAGGTGAGGGGCGCCGCTCGGGGCCCTCCTGCCGCCCGGGGCGGGGTCTCAGTGCCCCTTCTTCCCCGCAGGCCACCAGACGAGTCTGCACAGGGCCCGAGCGCTGCTGGAGGAGCCCGGTGTGCCTGCGCTTGCCCGATTCCCAGCTCTGTCCTCTCAAAGGAAA