Transcript asmbl_1032

Sequence
Transcript Sequence for observation asmbl_1032 of TGE0007816:
GGGAGCGGGATCTCGACTTCCGTATTTACCAATGGCTCCAAAACATACCTCACGTGCAACTTGAGTAGCAGCAACACTGAGATCGTCGGCCACCGCTGGATGAAAGGGGACAAGGTGCTGAAGGAGGATGAGCTGCCCGGCCTGAAAACGGAGTACGAGTTGGACACAGATGAGAGTGGGGGCCAGTACCTCTGTGTCTTCCTCCCGGAGGTCGTGGGCAAGGCCAGCATCAATGTGCCAGGACCCCCCAGAGTGAAGGCCGTGAAAAAGTCAGAGCACGCCACCGAGGGGGAGGGCGTCGTGCTGGCCTGCAAGTCTGAGTCCTTCCCCCCGATCACCGAGTGGGTGTGGTACAAGGTGAGTGACACCGAGCAGCAGGTCCTCACCAACAACTCCCAGAATAAGGTCTACGTGGTGTCCGTGGAGACCAGGACGGAGCTTCACATCCTGAACCTGAACTTGGAGACCGACCCCGGCAAGTACGTCTGCAACGGCAGCAGCGTGGAGGGCACCGACCAGGCCGTCATCGTCCTGCACGTTCGCAGCCAGCTCGCCGCCCTGTGGCCCTTCCTGGGCATTGTGGCCGAGGTGCTTGTGCTGGTCACCATCATCTTCATCTATGAGAAGCGGCGGAAGCCGGACGAGGTCCTGGATGACGAGGACACCGGCTCCGCGCCACTGAAGAGCAGTGGGCACCACGTGAACGACAAGGGCAAGAACGTCCGCCAGAGGAACTCCAGCTGAGCGTGCCACCAGACGAGTCTGCACAGGGCCCGAGCGCTGCTGGAGGAGCCCGGTGTGCCTGCGCTTGCCCGATTCCCAGCTCTGTCCTCTCAAAGGAAACCTGCCCAGCGAGAGCAAACGCTGCGAATCCCAGTCACATTTCCTCTCCTTTTAAGAAAACTAAGCTAAGGTTTTCTCTCTGTAGAGTTCCGTTCCTTAGGGGTTTCGTTCCGTCTTTTTAAGAGTGTTCCAGGGGAGTCTCAAGCTTCTCTGTGGGGCCCTAATGCCCCCTCCCCCTGTGTCCCCTTGCTGTCCCCTGGGCGTCCAGCCTTCTAGTCCATCACGTTGGGGCTGCGGGGGGCAGACTGGCCTTTACCTGACACTCCCACCACGGCTCTGCCTCTGAGGCTGCTCAGTGGTCCCTGTCCTCTGCGGAAGGTCATAGGTCGTGGTGCCCAGCATCCTGCCTGTCTGGAGCCAGTGCTGTCACATCACCTCAGGTCTGTGTGACGTGGGACATCCCTGCCCTCATGGCCACCTATCAGGTGTCCTCTTCACTGCTCGGGCAAGTCCCTGTGCTGGGGGTGGTCTGGTTGACCATCTCAGAGCGGGAGTCCTGTGACAGCCCCTTCCCCGTCAGCCCGTGGCCATGCAGAAACGCCCTCCCCCCCGGGCCCACAGCCTTACTGTCCACAGCACCCTGACTCCGGTACCTGCCCCCTGCCTGCTCACCAATAAAGGCTACCCCACCTCGTC