Transcript asmbl_9816

Sequence
Transcript Sequence for observation asmbl_9816 of TGE0003530:
GCCGCCGCGACCGTCTCGCCGGCGCTCCGCGGGTAAGCGCTCCTGCCCGAGCCTCGCGGGATCAGCTTTTCCCTGGTTGCGGGCGTTTCCGTACTGTCGCCCCCTTCACCTTGGATCATGTTCAAGAAATTCGACGAGAAGGAAAACGTGTCCAACTGCATCCAGCTGAAAACGTCCGTTATTAAGGGCATTAAGAACCAGTTGACAGAGCAGTTTCCAGGCATCGAACCGTGGCTTAACCAAATCATGCCCAAGAAAGACCCCGTCAAAATAGTGCGGTGCCACGAGCACATAGAGATCCTCACGGTCAACGGGGAGCTGCTGTTTTTTAGACAAAGAGAAGGGCCTTTTTACCCGACGCTGAGGCTGCTCCACAAGTACCCGTTTATCCTGCCGCGCCAGCAGGTGGATAAAGGAGCCATCAAATTTGTCCTCAGTGGCGCGAACATCATGTGTCCAGGCCTGACGTCTCCCGGGGCCAAGCTGTACCCTGCCGCGGTGGATACGGTGGTGGCCATCATGGCGGAAGGAAAACAGCACGCCCTGTGTGTCGGAGTCATGAAGATGTCTGCGGAAGACATCGAGAAAGTCAACAAGGGGATCGGCATCGAAAATATCCATTATCTAAACGACGGACTGTGGCACATGAAGACGTATAAATGAGCCGCAGAAGGAGTGCGCCTGCGCCGATATGGACATTGTGCTGTGGCTGTGTTTGTGTCTGTGTGGCGGTATGAAGACGGTACCTCTGTGGTTACGTCGAATAAATTCAATGGATGCT