Transcript asmbl_9770

Sequence
Transcript Sequence for observation asmbl_9770 of TGE0003523:
GTGGCTCCGAGTGCGCCTGCGCGGAGCGCCGGGACAGGGCGTGTTCCTCGTTCGGGTGCGCGTCTACCTCAGGCGGGCTGCGGTTTTCCCTCCCCGCAGTCGTGCGCCCTGCGGGACCCCGTCATTTCTACGCCCAGCCTGATACGTGCCGCTCTCCGCGATCATGTCCAAGTCTCTGAAAAAGTTGGTGGAGGAGAGCCGGGAGAAGAACCAGCCGGAAGTGGACATGAGTGACCGCGGCATCTCCAACATGCTGGATGTCAACGGCCTGTTCTCCTTATCCCACATCACGCAGCTGGTCCTCAGCCACAACAAGCTAACAACCGTGCCACCTAACATAGCGGAACTGAAGAATCTGGAAGTGCTCAACTTTTTTAACAACCAGATTGAGGAGCTGCCCACACAGATCAGCAGCCTTCAGAAACTCAAGCACCTGAACTTGGGCATGAACAGACTAAACACTTTGCCTCGAGGATTTGGCTCCCTCCCAGCCCTTGAGGTCCTTGATTTGACTTACAACAACTTGAATGAAAATTCTCTTCCTGGAAATTTCTTCTACCTGACCACCCTGCGTGCACTCTATCTAAGTGACAACGATTTTGAAATCCTGCCGCCAGATATTGGGAAGCTCACAAAGTTGCAGATACTCAGCCTTAGGGATAACGACCTGATCTCGCTGCCTAAGGAAATCGGGGAGCTTACTCAGCTTAAGGAGCTCCACATTCAGGGGAACCGCCTGACCGTTCTGCCCCCAGAACTAGGAAACTTGGATCTGACTGGTCAGAAGCAGGTATTCAAAGCAGAGAACAACCCCTGGGTCACCCCGATCGCTGACCAGTTCCAGCTTGGTGTGTCCCATGTATTTGAGTATATCCGTTCCGAGACGTACAAGTATCTCTACGGCAGACACATGCAGGCAAATCCAGAACCGCCGAAGAAAAATAATGACAAAACGAAAAAGATCAGCCGGAAGCCTCTGACAGCCAAGAACAAATGAGGGGTTGGCATGGGCTGGACTTCCGGTCACTTCGCTCGTTATTACTTCTGTTCTCTTGCTCTGTCCCACGATCAGTTATGGTTGACCCTTGAGCAACTTGGGTTTGAACTGAGCGGGTCCATTATATGCAGATTTTCTTCAATAAATTCTGCAAATGTATTTTCCTAATGATTCTCTTAAGATTTTCTTTTCTCTAACTTTGGTATAAGAATACAGTATATAATATGTATAACATACAAAATAGGTGTTAATAGACTGTTTACGTTAATAGACAGGAGGCTATCAGTAGTAAAGTTTTGGGGTGTCAGGTTATATGTGGATTTTCAACTGTGTAAGGGGGCGGCACCCCAACCCTCACATTGTTCAAGGGTCAACTGTACAGTGTGTATCTCTGAGTGTGTGTGAGTGCATGTGTTTCTTTTCATATTTTTCTTCCTACTGCTTACCAATTTTTATCTTTTAATTTCTTTTGGTAGGTAGTAGATTTTTATAAGTTTTAAAAACCCTTTCTTACCTTAAAAATTACCAAAGGCAGGAAACAAAGCTCTGATTCAACTGCTAATTCCGTAGTAGGCACTGATTTCAGCTCCTTGAATAGATGCTCGTAAAGTCGCTGCTTATCAAAAGCATAATTAAAATCACGTAATCGTTTAAATGTCACAGCACTGTTCACGCTTCTGTTTATTCATGTAATTCATTCTTTCGCCTTATTAAAAATTTTCCTTCGCCACTGAGATATTATGTTAACTTTCTTCACATACGATTTTAATAAAATCTTGAATTTGCACAACGTGTTGCCTCCTGAATACAGAACAATCTGACTTTGGGGTGTATACACATTTTTGTTTACTCTTTTTCCCAAAATTAATCTTGTCCACTTTTATTGGTTGTAGATGATAAACCCTGAAACTTCTCATGAAAAAAATGCAAAATTAAAGTTAGTTTC