Transcript asmbl_9703

Sequence
Transcript Sequence for observation asmbl_9703 of TGE0003514:
AATGATTCTCCAGGCTGCCTCTCCTAGAAAAGTCATCTTCTCACGAACCTTTAAAATTTCTGCCTCCCGAGGCAACCTTAAAGGACTAGGGCTGACTGCCTCATCTTTTTCTCCCTTGCAAAAGTCCCGTTTGCCACCATGGGGATGTACCAAGTGAGACCAAGTAGGGGGAGCGAATGGTGACTGGTACGCTGGGCTTACTGGCTGCTGCCCACTTCAGCGCTAGCACACTTCTGTAAGATCGGAACTGAGTACTAAACAACCTCTACACTTCCCCCTGGCGCCATTCCAGGGCTGGCGCCACATTCCCTGGTGGGCACGCAATGGCCGCGCCCCCTCCAGCGGCGGACGGGTCTTTTGGTTGCCATGGATCGGATGAAGAAGATCAAACGGCAGCTGTCAATGACACTCCGAGGGGGCCGAGGTGTAGACAAGACCAATGGTGCCCCTGAACAGATAGGCCTGGATGAGAGTGGCGGTGGCGGCGGCAGTGACCTTGGAGAGGCCCCTACTCGTGCAGCCCCTGGAGAACCTCGCTCTGGACGGGGACCACTCAGCTCTGCACCAGAGATTGTACACGAGGACTTGAAGATGGGGTCTGACGGGGAAAGTGACCAGGCTTCAGCCACATCCTCAGATGAGGTGCAGTCGCCAGTGAGGGTGCGCATGCGCAACCATCCCCCACGCAAGATCTCCACTGAGGACATCAACAAGCGCCTATCACTACCAGCTGACATCCGGTTGCCCGAGGGCTACCTTGAGAAGCTGACCCTCAATAGCCCCATCTTCGATAAGCCCCTCAGCCGCCGCCTCCGTCGTGTCAGCTTGTCCGAGATTGGCTTTGGGAAACTGGAGACATATATCAAGCTGGACAAGCTGGGCGAGGGTACCTATGCCACCGTCTACAAAGGCAAAAGCAAGCTCACAGACAACCTTGTGGCACTCAAGGAGATCAGACTGGAACACGAAGAGGGGGCACCCTGTACGGCCATCCGGGAAGTGTCCCTGCTCAAGGACCTCAAACATGCCAACATCGTCACACTACATGACATTATCCACACTGAGAAGTCCCTCACTCTTGTCTTTGAGTACCTGGACAAAGACCTGAAGCAGTACCTGGATGACTGTGGGAACATCATCAACATGCATAATGTGAAACTGTTCCTGTTCCAGCTGCTCCGTGGTCTGGCCTACTGCCATCGGCAGAAGGTGCTACACCGTGACCTCAAGCCCCAGAACTTGCTCATCAATGAGAGAGGAGAGCTTAAGCTGGCTGATTTTGGCCTGGCTCGGGCCAAGTCAATTCCAACAAAGACCTACTCCAATGAGGTGGTGACACTATGGTACCGGCCCCCTGACATCCTGCTTGGGTCTACAGACTACTCCACCCAGATTGACATGTGGGGTGTGGGCTGCATCTTCTATGAGATGGCCACGGGCCGGCCCCTCTTCCCAGGCTCCACAGTGGAGGAACAGCTACACTTCATCTTCCGCATCTTGGGAACCCCAACTGAGGAGACATGGCCGGGCATCCTGTCCAACGAAGAATTCAAGACATACAACTACCCCAAGTACCGCTCTGAGACCCTTTTGAGCCATGCACCCCGACTTGACAGCGATGGGGCTGACCTCCTTACCAAGCTGCTGCAGTTTGAAGGTCGCAATCGGATCTCCGCAGAGGACTCCATGAAACACCCATTCTTCCTCGGTCTGGGGGAGCGGATCCACAAACTTCCTGACACTACTTCCATATTTGCACTAAAGGAGATCCAGCTACAAAAGGAGGCCAGCCTTCGCTCTTCGTCAATGCCTGACTCAGGCAGGCCAGCTTTCCGTGTGGTGGACACCGAGTTCTAAGCCACAGACCCAGGCCCCAGCAGGCAGCAGCTGGAGGGATGCCACACCCCTCACAGGGCAGACCCCAACTGCATCCTCCCTGCTTGCTACCTGCCTGACTCATGCTCGCCTGCCCACATGTCCCCTGCTGCCTGTCCAAAAACACATGATCATTGGCCTGTCAACCCACCCATTGGCCTGTCTGCTGGGTGCTAACAAAGCTCTCAATGCTCCTTGCCTGGTCTGTTTGTCTCTCTCTGTCTCAGTAGTTGCCGGCGGACAGCATGGCCGTGCCAGCCTCCCACACTGAGGCCAGGCCTATACCCCTCCCCATCATACCCTCCCCCAGGACCACTACCCCATGGCCAGCCAGGGGTCTGGAGCTAGCCCAGGCTGGGGATCTCGACTCAGACAAGATGGGGATGCCTTGAGTCTGAGGTTTCCCCTGCTTGCTTTCCTGCCTGTCCCACCTGCCTCATGTTGTGTGGGCTTTTTTGTTGTTGTTCATTTCATTCATTGTTTTTTAATTATTTTAAATGAGGTTTTCATTTTTTAAATGCAATATCTCTATACAGACTGGCTGGGCCCCACCCCCTGCGTGTGGCCCTCCCACAGTATTTTGTGCAATGAAGCCCCGCTCCCAGCCTTTCCAAGGCAGGGACACAGCCCCTATTCAGAACCCTGACCATCACCAGACCCTGGGATCGGCTAAGGGAAAGCATGCCTCAACCACTCGCCTTCCTACCCCCCACCTGCCATCCCCAGCCGCAGGGGTACCTGGGGACTACTGGAGACTCTGGGAGATGGACAAGGTTGGGGCCCCAGTCTTTCCCTCTTACAGTCCCATAGCTGGGGCCTCCTTCCTTCTCAGGGTCTCCCTAGCCCAGCCCTCTTGCCCCCACCCCACTCGGTGCTGTTGAGTAGGGGCCCTGCCAGGAACTGACCAACTCAGTGAGGAGCCATAGTATGTCTATGTGCACAGGCAGGGACAGAGGGGCTGGCGGGGGGATGGGGTGTGTGTGCC