Transcript asmbl_9702

Sequence
Transcript Sequence for observation asmbl_9702 of TGE0003514:
AATGATTCTCCAGGCTGCCTCTCCTAGAAAAGTCATCTTCTCACGAACCTTTAAAATTTCTGCCTCCCGAGGCAACCTTAAAGGACTAGGGCTGACTGCCTCATCTTTTTCTCCCTTGCAAAAGTCCCGTTTGCCACCATGGGGATGTACCAAGTGAGACCAAGTAGGGGGAGCGAATGGTGACTGGTACGCTGGGCTTACTGGCTGCTGCCCACTTCAGCGCTAGCACACTTCTGTAAGATCGGAACTGAGTACTAAACAACCTCTACACTTCCCCCTGGCGCCATTCCAGGGCTGGCGCCACATTCCCTGGTGGGCACGCAATGGCCGCGCCCCCTCCAGCGGCGGACGGGTCTTTTGGTACGTGCAGTCCGAGGTTGCCATGGATCGGATGAAGAAGATCAAACGGCAGCTGTCAATGACACTCCGAGGGGGCCGAGGTGTAGACAAGACCAATGGTGCCCCTGAACAGATAGGCCTGGATGAGAGTGGCGGTGGCGGCGGCAGTGACCTTGGAGAGGCCCCTACTCGTGCAGCCCCTGGAGAACCTCGCTCTGGACGGGGACCACTCAGCTCTGCACCAGAGATTGTACACGAGGACTTGAAGATGGGGTCTGACGGGGAAAGTGACCAGGCTTCAGCCACATCCTCAGATGAGGTGCAGTCGCCAGTGAGGGTGCGCATGCGCAACCATCCCCCACGCAAGATCTCCACTGAGGACATCAACAAGCGCCTATCACTACCAGCTGACATCCGGTTGCCCGAGGGCTACCTTGAGAAGCTGACCCTCAATAGCCCCATCTTCGATAAGCCCCTCAGCCGCCGCCTCCGTCGTGTCAGCTTGTCCGAGATTGGCTTTGGGAAACTGGAGACATATATCAAGCTGGACAAGCTGGGCGAGGGTACCTATGCCACCGTCTACAAAGGCAAAAGCAAGCTCACAGACAACCTTGTGGCACTCAAGGAGATCAGACTGGAACACGAAGAGGGGGCACCCTGTACGGCCATCCGGGAAGTGTCCCTGCTCAAGGACCTCAAACATGCCAACATCGTCACACTACATGACATTATCCACACTGAGAAGTCCCTCACTCTTGTCTTTGAGTACCTGGACAAAGACCTGAAGCAGTACCTGGATGACTGTGGGAACATCATCAACATGCATAATGTGAAACTGTTCCTGTTCCAGCTGCTCCGTGGTCTGGCCTACTGCCATCGGCAGAAGGTGCTACACCGTGACCTCAAGCCCCAGAACTTGCTCATCAATGAGAGAGGAGAGCTTAAGCTGGCTGATTTTGGCCTGGCTCGGGCCAAGTCAATTCCAACAAAGACCTACTCCAATGAGGTGGTGACACTATGGTACCGGCCCCCTGACATCCTGCTTGGGTCTACAGACTACTCCACCCAGATTGACATGTGGGGTGTGGGCTGCATCTTCTATGAGATGGCCACGGGCCGGCCCCTCTTCCCAGGCTCCACAGTGGAGGAACAGCTACACTTCATCTTCCGCATCTTGGGAACCCCAACTGAGGAGACATGGCCGGGCATCCTGTCCAACGAAGAATTCAAGACATACAACTACCCCAAGTACCGCTCTGAGACCCTTTTGAGCCATGCACCCCGACTTGACAGCGATGGGGCTGACCTCCTTACCAAGCTGCTGCAGTTTGAAGGTCGCAATCGGATCTCCGCAGAGGACTCCATGAAACACCCATTCTTCCTCGGTCTGGGGGAGCGGATCCACAAACTTCCTGACACTACTTCCATATTTGCACTAAAGGAGATCCAGCTACAAAAGGAGGCCAGCCTTCGCTCTTCGTCAATGCCTGACTCAGGCAGGCCAGCTTTCCGTGTGGTGGACACCGAGTTCTAAGCCACAGACCCAGGCCCCAGCAGGCAGCAGCTGGAGGGATGCCACACCCCTCACAGGGCAGACCCCAACTGCATCCTCCCTGCTTGCTACCTGCCTGACTCATGCTCGCCTGCCCACATGTCCCCTGCTGCCTGTCCAAAAACACATGATCATTGGCCTGTCAACCCACCCATTGGCCTGTCTGCTGGGTGCTAACAAAGCTCTCAATGCTCCTTGCCTGGTCTGTTTGTCTCTCTCTGTCTCAGTAGTTGCCGGCGGACAGCATGGCCGTGCCAGCCTCCCACACTGAGGCCAGGCCTATACCCCTCCCCATCATACCCTCCCCCAGGACCACTACCCCATGGCCAGCCAGGGGTCTGGAGCTAGCCCAGGCTGGGGATCTCGACTCAGACAAGATGGGGATGCCTTGAGTCTGAGGTTTCCCCTGCTTGCTTTCCTGCCTGTCCCACCTGCCTCATGTTGTGTGGGCTTTTTTGTTGTTGTTCATTTCATTCATTGTTTTTTAATTATTTTAAATGAGGTTTTCATTTTTTAAATGCAATATCTCTATACAGACTGGCTGGGCCCCACCCCCTGCGTGTGGCCCTCCCACAGTATTTTGTGCAATGAAGCCCCGCTCCCAGCCTTTCCAAGGCAGGGACACAGCCCCTATTCAGAACCCTGACCATCACCAGACCCTGGGATCGGCTAAGGGAAAGCATGCCTCAACCACTCGCCTTCCTACCCCCCACCTGCCATCCCCAGCCGCAGGGGTACCTGGGGACTACTGGAGACTCTGGGAGATGGACAAGGTTGGGGCCCCAGTCTTTCCCTCTTACAGTCCCATAGCTGGGGCCTCCTTCCTTCTCAGGGTCTCCCTAGCCCAGCCCTCTTGCCCCCACCCCACTCGGTGCTGTTGAGTAGGGGCCCTGCCAGGAACTGACCAACTCAGTGAGGAGCCATAGTATGTCTATGTGCACAGGCAGGGACAGAGGGGCTGGCGGGGGGATGGGGTGTGTGTGCC