Transcript asmbl_9033

Sequence
Transcript Sequence for observation asmbl_9033 of TGE0007905:
AGCAACAGCAGCAGCAGCAGCAGCCTCGCCCTCCTCCTCGCCAGCAGGAAAGAGCCCACTTGGAGAGTCTGGGGCTCAGTAGGCCTAGTCCCCAGCTGTTGGCAGAAACCCCTGTGCCTGGCCTCCCTGAGTTCCCACGGGCAGCCTCCCAGCAGGAGATCGAGCAGTCCATCGAAACCCTCAACATGCTGATGCTGGACCTGGAGCCAGCTGCGGCTGCCGCCCCCCTGCACAAATCCCAGAGTGTCCCAGGGGCCTGGCCAGGGGCCTCCCCGCTCTCTTCCCAGCCCTTCTCCGGCTCCTCCTGCCAGTCCCATCCGCTGACCCAGTCCAGATCTGGCTACATCCCCAGTGGGCATTCCTTGGGAACCCCTGAGCCAGCTCCACAGGCCTCCCTGGAGTCCGTCCCTCCTGGCAGGCCTTACTCACCTTATGATTATCAGCCATGTCCGGCTGGGCCCAACCAGAGCTACCGTCCAAAGAGCCCAGCTTCCTCCTCCACGTCCTCTGCCTTCCTTCCAACCACTCACAGCCCTTCAGGGCCTCAGCAGCCTCCGGCATCTCTCCCTGGCCTCACCGCTCAGCCTCAGCTCTCACCAAAGGAAGCGACTTCAGATCCATCCCGAACTCCGGAGGAGGAACCCTTGAACTTGGAGGGGCTAGTGGCCCACCGGGTAGCAGGGGTGCAGGCTCGGGAGAAGCAGCCTGCAGAGCCCCCGGCCCCTCTCCGGAGGCGGGCGGCCAGTGATGGACAGTATGAGAACCAGTCTTCAGAACCCTCATCTCCCCGGAGCCCTGGGGTTCGCTCCCCTGTCCAGTGCGTCTCCCCAGAGCTGGCTCTCACCATCGCTCTTAATCCTGGAGGACGGCCCAAAGAGCCCCATCTGCACAGCTACAAGGAGGCTTTTGAGGAGATGGAGGGAACCTCTCCGACCAGCCCACCGCCCAGTGGGGTGCGCTCCCCTCCAGGTCTGGCCAAGACACCCCTGTCTGCTCTGGGCCTGAAACCCCACAACCCAGCGGACATCCTGTTGCACCCCACAGGTGAGCCTCGGAGCTACGTCGAGTCGGTGGTGCGGACGGCAGTAGCTGGGCCCCGAGCTCAGGACCCTGAGCCCAAGAGCTTTAGCGCCCCAGCTGCCCAGGCCTATGGCCATGAGACGCCCCTGAGGAATGGGACCCTGGGTGGCTCCTTTGTCTCCCCCAGCCCCCTCTCCACCAGCAGCCCCATCCTCAGCGCTGACAGCACTTCAGTGGGGAGTTTCCCGTCAGGAGAGAGCAGTGACCAGGGCCCCCGGACACCCACCCAGCCTTTGCTGGATTCCGGCTTCCGCTCCGGCAGCCTGAGCCAGCCCAGCCCTTCGGCTCAGAGAAGCTACCAGAGTTCTTCTCCTCTCCCGGCCGTGGGCAGCAGCTACAGCAGCCACGACTACTCACTGCAGCAGTTCAACTCCCCAGAAAGCCAGGCCCGGGCTCAGTTTGCTGTGCCCAGCGTCCACACGGTACCCGGGAGCCCTCAGGCACGCCAGAGGACAGTGGGCACCAATACTCCCCCTAGCCCTGGCTTTGGTCGCCGAGCCATCAACCCCAGCATGGCTGCCCCTGGCAGCCCCAGTTTGAGCCACCGCCAGGTGATGGGCCCATCAGGAGCTGGTTTCCATGGTAACACAGTTTCCAGCCCCCAGAGCAGTGCAGCGACCACTCCAGGAAGCCCCAGCCGGGGCCAGCACCCTGGGGCCCACCAGGCCTCAGGCCTCCATGGCAGTGTGGTCACCACTCCAGGGAGCCCAAGCCTGGGCCGGCACCCAGGAACCCACCAGGGCAACCTGGCCCCCAGTCTCCATGGCAACACAATAGCCAGCCCCGGAAGCCCCAGCCTGGGCCGGCACCTGGGAGGATCTGGATCTGTGGTTCCCGGAAGCCCCAGCTTAGACCGGCACGTGGCCTATGGCGGCTACTCCACCCCTGAGGACCGGAGACCCACGCTGTCCCGGCAGAGCAGTGCCTCCGGCTACCAGGCTCCCTCCACGCCCTCCTTCCCTGTGTCCTCTGCCTACTACCCTGGTCTGAGTAGCCCTGCCACCTCCCCCTCGCCGGATTCAGCAGCCTTCCGGCAAGGGAGCCCAACACCGGCCTTGCCAGAGAAGCGGAGGATGTCCATGGGAGACCGGGCGGGCAGCCTCCCCAACTATGCTACCATCAACGGGAAGGTGTCCTCCTCGCCTGTCGCCAGCGGCATGTCCAGTCCCAGTGGGAGCAGCACCGTCTCCTTCTCTCATACTCTGCCTGACTTCTCCAAGTACTCCATGCCAGACAACAGCCCTGAGACCCGGGCTAAAGTGAAATTTGTCCAGGACACTTCCAAGTATTGGTACAAGCCTGAGATCTCTAGAGAGCAGGCCATCGCACTCCTGAAGGACCAGGAACCAGGGGCCTTCATCATCCGTGACAGTCACTCCTTCCGAGGGGCCTATGGGCTGGCCATGAAGGTGTCATCTCCCCCTCCGACCATTATGCAGCAGAATAAAAAAGGGGACATGACCCATGAGCTGGTGAGACATTTCCTGATAGAGACTGGCCCTAGAGGAGTCAAGCTCAAGGGGTGCCCCAATGAGCCAAACTTTGGATCCCTCTCTGCCCTGGTCTACCAGCACTCCATCATCCCACTGGCTCTGCCCTGCAAGCTGGTCATTCCAAACCGAGATCCCACAGATGAATCGAAAGATAGCTCAGGCCCTGCCAACTCAACCACTGACCTGTTGAAGCAAGGGGCAGCCTGTAACGTGCTCTTCGTCAACTCTGTGGATATGGAGTCACTCACTGGGCCACAGGCCATCTCCAAAGCCACTTCTGAGACACTGGCTGCTGACCCCACGCCGGCTGCCACCATTGTTCACTTCAAAGTTTCTGCCCAGGGAATTACACTGACTGACAACCAGAGGAAGCTCTTCTTCAGACGACACTACCCCCTCAACACTGTCACTTTCTGTGACCTGGATCCACAGGAGAGAAAGTGGATGAAGACGGAGGGAGGGGCCCCTGCTAAGCTCTTCGGCTTTGTGGCCCGGAAGCAGGGCAGCACCACGGACAACGCCTGCCACCTCTTCGCTGAGCTTGACCCTAACCAGCCTGCTTCCGCCATTGTCAACTTTGTCTCCAAGGTCATGCTGAGTGCTGGCCAGAAGAGATGAACCCACCCCTTGCCTGGGGCCAGGGCAGTGGGGATGGGGCATGTGGGGGCGGGGAGACCCATGAATCCTGACCACCTTTAAATCCAGAAGGAGGACTTTGGGCTAATTTTGGAGAAGGAGAGAAGAAAGTGCAATGTGGGGAGAGGGAAGTGAATCGCAGAGGGGAGGGGGAGAGCGGGAGAGAAAGAAAGAAAAAGATGGAGGAGGATTACTGGGATTCCTTTGGTTAGATGGATACTACGTAACCCCAAAGCCTCCCAAACTAACCAGGTCCACCTAACTCTCCCTCACCCTCCCAGAAGACAGAGTTTCTCAAAGGAGGCAGAACGGACCTCCTTGGGGATCCATGTTTTGAGGGGAATGGAAAAGCTCTGTCTCCCTAGCCCTGCTTTGCAAGGAGAAATCAAGTTGAGAGAATCTTTTTCCGGCGATCTCTAGGGTAGATTGCCAAACCAAAAAGAGCCAGCATGGGACGTCAAGGGGCAGGACTTTTGTTTTTGAAGGTAACTCAGACCCGAGGCACCTAAGGTCTCTTTGCTCTGTCTCCGATGTATAGTTCATGTGGGTATATATGTAGGGTGTGTATATGTCCACACCCACATCCTCACACACTGATTTATATTTGCCTCTCAGCTCGCATTATAAACAGGTGTACTTGTCCGTGTCCATGCGTTTGCACACACGTGCATATCGTCCAAAGAAGGTTAGAGTTGGGGTGACACAGCAGAGGAAGGGGACATCAGCCCTTCTCCCCAGGAGCACCCAGGAATATGGGTAACAGACTCTGTCTCGGTCCCTGCACCTGCAGCCTAGTAGCCCTGGGTGCCAGCAGGAGCGGGGCCGGCCACCTGCAGCATCCCTGTTCTGCCTTGGCCAGGAGGCAGGAGCACTGATGTGAGGAGATGGGGGACACGAATGCCCATCGCCTTGGGGAAGAGATCCGTCAGCCGTGGTGGCTGCAGAGCTCCGGGCATCTCTCCTGAGGCGTGTGGCCCAGCGGTGAGGTGGCTGGGTCGCTCCTGCCAGTCCCAGGCCTCAGCCCGTCCTTGGGTGCCCCGCCCAGACCAGCCTTATCTCAGACTTGCTTATCTGCATGGTGTCTTATTGGGTGCTGGAGATTGAGCCTTCCTGCTCTGCCCTGCCCTGCTCTGTCCTGCAGGGTCCCCGTGTTGGGCTCATCCAGGGGATCCTGCTTCTAAGAGTCCTGCTCAGCGAGGCCCGGGGGAGACTCCTGTCGTCCTTGTACCCCCGTCTGCAAGTGTTTTGGGGCCCGACTTTTGCTGGGCTGTCCAGGTGACTTAGTAGAGCTCTGGGGGCTGCTACCTGTACACCACATGGCCTACCTACAATACCAAAGCCTTGCTGTTCCCCCTTCTGCCTTGGTTTCCCCAGCAGAGCCAAGCTGCTCGTGAGTGGAGGGCAGAAGGCACACATTTAGGCCAAAGGGCAGTTGGGAACCCCTCAACCTCCACCCAAGGACTCTAAGCTGGAATGGAAAGTCTACCAGGATTCCATTCTTGAGGGGTTTCTTAAGCCTCTGGGGGTCCCCTAGAGAGAGGCATTGTATTGATATATAAATATATATAATATATATGTGAGACATACTGACAGAATCTGTAAGCTAATAAAATATAAGAAAAGGTTAAAAAAAGAATAGGTAAATTGACAAGAAGTATTTATTATTTTCCCATATTGCTTTATTGCCTCCCTGGGCGTAAACCAATTCCCATCCCTCTTGATATGTTTAAGTGAAGCCTGAAATGTGGGGACCTTTTTCTTTGGAGCAATCAGGGGTCTCCTTGCCCTGGCCTTGACCTTCCCCAGACTCTGTCTGGGGCTCAGCGGGGAGGGGTGCACGTGTTCCACCCCCTTTGGCCCCCTTATTTTCTGGCAAGCCCAGGACTCAGCCATCAGCTCCCGAGATGAGAAGAGAGCTGTCTGCTTACTGCGGCTCCGGCCCCAGCGGGCCGGCGGGGGACATGCGTGTTTGTGGCTGGCTTGGGCAATGTGTGCATCTTTTGTATTTTTTTCTCCTCCGAGAAGCTGTGTCTGTGTGGGCCTTCTGTTTCAGGAGAGTGTCTATAGAGTGTCTAAAGTGGGGGCAGCCCCCACTTCCCAAAGATTGAAACCTTGTGCTTGGTGACCAGGCTCCTCCACAGTGCTCTTCCTTCTGAGGGCGTTCAAGCCAGATATCCGGAATTCCCTCTCCTCAGTCCCTCCTACCCCGACTCTCTTCCCAGGTGGGAGATATCCTGCCTCCTCCCTTTGTACATATCTTACCCTCCCACGGGACAGCCCGGGGACACTCTCCTGGTCTGGATGTCCTCGCCACACTTGAGGCCGGGTGGCGTGTGAGACCGTTCTGCGGACCCAGGCCTGGGGTCAGCCTTCTCACGTGCTTTCCCACTGCCCACCACGGCCCATCTCCCAGGCACGGCCAGAGCACCCCACCCAGGCCTGAGCTGAGTGTGACCCTTGGGGTGCCAGGAAGCTGATCGACTCACTCCCTGCTGTTGCTTTGGAAGGAGTCGATTTCCTGGAGCTTGGCCTTTCCGGAAGAATGATGGGGAAGGGCACCTCAGTCTCCACGGTAGCCCCCCACTTTGGGTCAGACACTGGTTGGGAAGACACTGTAGCCCTCCCATGTCTCACAGGTTAGGCCTGTGCACCCATGCGTGCACACACACACACACACACACGCACACACGCACACATGCGCGCACACACA