Transcript asmbl_8362

Sequence
Transcript Sequence for observation asmbl_8362 of TGE0023345:
GCCCAGAGCAAGAGAGGCATCCTGACCCTGAAGTACCCCATCGAGCACGGCATCGTCACCAACTGGGATGACATGGAGAAGATCTGGCACCACACCTTCTACAACGAGCTGCGTGTGGCCCCCGAGGAGCACCCTGTGCTGCTGACCGAGGCCCCCCTGAACCCCAAGGCCAACCGTGAGAAGATGACTCAGATTATGTTCGAGACCTTCAACACCCCAGCGATGTACGTGGCCATCCAGGCCGTGCTGTCCCTGTACGCCTCTGGCCGTACCACTGGCATCGTGATGGACTCCGGTGATGGAGTCACCCACACTGTGCCCATCTACGAGGGGTACGCCCTCCCCCACGCCATCCTGCGTCTGGACCTGGCTGGCCGGGACCTGACGGACTACCTCATGAAGATCCTCACGGAGCGTGGCTACAGCTTCACCACCACGGCTGAGCGGGAGATCGTGCGTGACATCAAGGAGAAGCTGTGCTACGTCGCCCTGGACTTCGAGCAGGAGATGGCCACTGCGGCCTCTAGCTCCTCCCTGGAGAAGAGCTATGAGCTGCCCGACGGCCAGGTCATCACCATTGGCAACGAGCGCTTCCGCTGCCCCGAGGCCCTCTTCCAACCCTCCTTCCTGGGCATGGAATCCTGTGGCATCCATGAAACTACCTTCAACTCCATCATGAAGTGCGATGTTGACATCCGCAAGGACCTCTACGCCAACACGGTGCTGTCTGGTGGGACCACCATGTACCCAGGCATTGCTGACAGGATGCAGAAGGAGATCACCGCCCTGGCTCCCAGCACAATGAAGATCAAGATCATTGCGCCCCCTGAGCGCAAGTACTCTGTGTGGATCGGCGGCTCCATCCTGGCCTCGCTGTCCACCTTCCAGCAGATGTGGATCAGCAAGCAGGAGTACGACGAGTCCGGCCCCTCCATCGTCCACCGCAAATGCTTCTAGGCGGACTGTTACTTAGTTGGTTATACCCTTTCTTGACAAAACCTAACTTGCGCAGAAAACGAGATGAGATTGGCATGGCTTTATTTGTTT