Transcript asmbl_8211

Sequence
Transcript Sequence for observation asmbl_8211 of TGE0007853:
GTCAGCCTAGGTCAGGAACATGGCCGCGCGGTCCCTATGGGCGGTCCGGTGGCGGGTACAGCGCCTCTTGTCCTCGAGTGCCGCGTCGGATGGCAGGGGATGTCTGCACCTTTTCAGCACCGCCACCCAGAGAACTGCTGGTGAGGACTGTAATTCTGAGGACCCTCCCGATGAGCTTGGGCCCTCTCTTGCAGAAAGAGCCTTAAAGCTAAAAGCTGTTAAACTAGAGAAGGAAGTCCAGGATTTAACAGTGAGATACCAGAGAGCTGTAGCTGATGGTGAAAACATAAGAAGACGAACTCAGAGATGTGTAGAAGACGCCAAGATATTTGGAATTCAGAGTTTCTGTAAGGACTTGGTAGAGGTGGCAGACATTTTGGAGAAGACTACAGAGTGCATTTCTGAAGAAACAGAGCCTGCAAACCAGAAGCTCACTCTGGAGCAGATATTCCGGGGGTTGTCACTTTTAGAAGCAAAGCTGAAAAGCGTGTTTGCCAAGCATGGCCTGGAGAAGATGACACCCATTGGTGACAAATACGACCCTCATGAGCATGAACTCATCTGTCATGTGCCAGCTGGTGTTGGGGTGCAGCCCGGCACAGTGGCATTGGTAAGGCAAGATGGCTACAAGCTTCATGGCCGCACCATTAGACTTGCCCAGGTGGAAGTGGCAGTGGAATCTCAGAGAAGACTCTGAATGGGCCATGAGGAACCAAATGTTCTTCCAGAGCGCAGTCACCTGTGTTTCCTTTATTTATTAAACTAGGTTTGTACATGAGGTACTTCATGTGATCTGTTTTGGATTTAGTCATATTGGCTTTATTTCTAAGATACTCTATTGATTTAATGTGACCTGTTCGGTCTCATCAGAAGTCTTGCCATTCGGCATTTGAACAATGTGACAAGTGTTTCTATGGCCTTTATGTTTAAGAAAATTATTTTTAAATTAGTTCTCTGAGGACTTTCAATCCAAAATCTTTTTAAAAGTTGGAAATGAGTATATGTTTATGTATTTTGGACTAATTGTTCCTTTCTGATAGTCCTTATAACAGGTATTGCATAGGATCTTGTGTATTTTGTGGGAAAAGAGATTGGTACATTTGGGTACTTAAGTGATAATGCTTTATAGTTGTGTGAATGTAGATCGTTTGGGTTGATTTTTATATACATAGATTTTTCAGGACTTTCTCTCTTTATTTTATTTTCCTTATAGCCATTTTTTGTCCTCGTAGTCCCTGCCAAGTAGAATTCATATTCACACTCATTGCTCTTTTCCGATTCCCATTTACAAGGCCTAAGGCTCAGGCTAAACTTGGAAGACAGGAAACATCAAGAAATTCCAGATACCCAGGTCCCTTTCAAGCAAGGATGGCCAAGAAACTTTGTGCTTTTTTTGCTGAGTTATCTTCAACTTATTTTCAGCCTCCTTGGTATATAATAATTTCAGGGAAACTGAGGCAGCTAATGACCTAAATTGGTCTATATAGGTAATTTACCTACAATTTCTCTTTTCACCAGCCTTGAAATCCTCTGCCACTTTGTCAAATTTAAATTATGATCCTTTATTAGATTATGGAGGGATGTGGTCAGGGAAAAAATGTTAGGTTCCCATTCCTTTCATTTAATTATGCTGAATTTTTTTTTTAATTGATACAATTCACTACCTCTCTTACATTGAAAAGTTTTGTTTCCTAGTTTTTGTATCTGTCATACATTTCGCTCCCCTTTTACATGTTAACCTAGACATATGAGCCTCTGTGTTTATTTTTGATTCTTTCAGTCTTGCTTCTTGTAGCTGGTGTTCTGTAAAAGATTTGTTCAATAAATGAGTTAGTGAATAAATGATACATCAGACTTTAGAAAGGAGGTCACTTATGCCTATTTTAATGTTAGAAGAGGCCTTGATGATGTAACCTTGCCCCTTCCACTTCTTCTGAGTATGAAAACAGACTTTTTAGAATTGGACTCAAAGAAAATGTCTAAAACTAGTGAACTAAATTTCAGTAAGAACTTGAATAAGGAACAACTAGATATTAACTTCAGTCATTTAAGATTCAACAGTTCTTTAATGAACTTGCGAAAATGTCCCCTGCAGACAATTAAATGTTAGCTGTCCAGATTGCATAGGTTTAGATTTAAGTTAGTTGCCCATAAAATAAATCCATTTCTACAGATACAGGAACCCTTGACCCCTTTCAGTGAAGTGGTAAAAATTATTCTCTTAGATATATATAATTCTAGAACAGTACACAGACTTCTGTCAATAAAGTCATCCCCCAGTGGGCCCTACCGTCTTCACCAGATTTAGACACTTTAAAAAAAAGTACATGATTTTAAAATGCACACAACACTGCTGGTATGATTTTAAAACCAGAACCTCTTTTGTCATTCCACTGAGTGCGTACTGTAAGTTTAATGAGCAGTCAGTTTCACAATAGGAATTTGTCTTTTTTTGCCTATATTCCTGAGATTGACAGATGATGACAAGAAAATGAGCCAATTATAATTACCCATGGGTTCTTGGATTACTAGCTGTCATTACCAGTGAATTAGAATAACCATAATTTTACATATGAAATGTTCTGATTACCTTAAGTTTTCTAATATTCCTTGGAACCTCCTGTTTTAGCAAGTAGATTGAGAATAATTTTTAGATTCTTTTATTAGTAGTTTTGTGGACTTAAAATTGTAAATTTAGAAGATGGAGCTATAACAGTAAGAATATAAAGTTGAAGGGCTTTCGGGAGCTAGAGCAGCATAATAGAGCAGAGAAGCTTGGTAGGCAGAGACTTGAACATGAATCCCAGCTCAGTCATCT