Transcript asmbl_8064

Sequence
Transcript Sequence for observation asmbl_8064 of TGE0007832:
CCCAGGCCTACCTCACCCAGGAGATGTATCTGCTTGCTGTAGTCTCAGAGACCAACCGGCTCGCCGCGACACCCAGCCTCTAGCCACCTTTGGCACATCTTAATAGATAGTAAACTATCTTTTTGAGGGCGAATCTTAATCTCCTTGGAAACGCTAAAGACGGCGTCTTCCGGGAAGCCTCGCCCCGTGACCTCAGACGTACACTTCCAGGGCACGAACGTGACCCGTCGCCCCGCCCTTTCCCACTCTCTCTTTCCGGTGGCGGAGTCTGGAGAAGGCACGCAGAAATGGCACCTCGCAAGGGGAAGGAAAAGAAGGAAGAACAAGTCATCAGCCTTGGACCTCAGGTGGCTGAAGGAGAAAATGTATTTGGTGTCTGCCACATCTTCGCATCCTTCAATGACACTTTTGTCCATGTCACCGATCTTTCTGGCAAGGAAACCATCTGCCGTGTGACTGGTGGGATGAAGGTAAAGGCTGACCGAGATGAGTCCGCTCCATATGCTGCCATGTTGGCTTCCCAGGATGTGGCCCAGAGGTGCAAGGAGCTGGGCATCACTGCCCTCCACATCAAACTCCGGGCCACAGGAGGAAATAGGACCAAGACCCCCGGACCAGGGGCCCAGTCAGCTCTTAGAGCCCTCGCCCGCTCAGGGATGAAGATTGGACGGATTGAGGATGTCACCCCCATCCCCTCTGACAGCACCCGCAGGAAAGGGGGTCGCCGTGGTCGCCGTCTGTGAACAGGACTCCTCAAATTGTTTTCTGTTAATAAATTGCCTTTGTGTGAGCTCTTTC