Transcript asmbl_8051

Sequence
Transcript Sequence for observation asmbl_8051 of TGE0014538:
CCGGGGCTAGCGCCCGAGTTCCCTTTCCCAGAGTCCTCTGCGCCGTGAAGAAGCGGCTCCCGGGGACCGGGGGCATTTTGCGTTGGCTGGAGCCGGAGTAACAAGATGGCGGCGTCGGCGGAGTGACAGGGGTCCCTCCGGGAGGGAGCCGGCAGCAGTGGTGGCAGCGGGATCGCCGCCCTAACTCACCGCGCCCCTTTTCCAGCCCGCGACGTCGCCGCGAAAGCGAGGCAGCAGCGGCCGCCCAGACACAAGTGGCCCAGCCTGGTAACCGCGAGGACCCCTCACACACTGCGGCCTGGCGAGAAGAAACCTGCCTGAGCGGCGGTGATCAGGTTCCCCTCGGCTGATTCCGGGCCTGGTAACGCCGAGCCAACGCTTTCAGCTTCCTGCCGCCCTCCTCCGCAGCCTTGCTCCGGGGACGAGCCCAGAGGCCTCCGTCCTCCTCTCAGAGGTGTCGGGGCTCGGCCCCAGCCCCCGTCTGCGCCTCTCAGGATGGCGAGCAGCAGCGGCTCCAAAGCCGAATTCATTGTCGGAGGGAAATATAAACTGGTACGGAAGATCGGGTCTGGCTCCTTCGGGGACATTTACCTGGCGATCAACATCACCAATGGCGAGGAAGTGGCAGTGAAGCTAGAATCTCAGAAGGCCAGGCATCCCCAGTTGCTGTACGAGAGCAAACTCTATAAAATTCTTCAGGGTGGGGTTGGCATCCCCCACATACGGTGGTATGGTCAGGAAAAAGACTACAATGTGCTAGTCATGGATCTTCTTGGACCCAGCCTTGAAGACCTCTTCAATTTCTGTTCGAGAAGGTTCACAATGAAAACTGTACTTATGTTAGCTGACCAGATGATCAGTAGAATTGAATATGTGCATACAAAGAATTTTATACACAGAGACATTAAACCAGATAACTTCCTAATGGGTATTGGGCGTCACTGTAATAAGTTATTCCTTATTGATTTTGGTTTGGCCAAAAAGTACAGAGACAACAGGACAAGGCAACACATACCATACAGAGAAGATAAAAATCTCACTGGCACTGCCCGATATGCTAGCATCAATGCACATCTTGGTATTGAACAGAGTCGCCGAGATGACATGGAATCATTAGGATATGTTTTGATGTATTTTAATAGAACCAGCCTGCCATGGCAAGGACTAAAGGCTGCAACAAAGAAACAAAAATATGAAAAGATTAGTGAAAAGAAGATGTCCACTCCTGTTGAAGTTTTATGTAAGGGGTTTCCTGCAGAATTTGCCATGTACTTAAACTATTGTCGTGGGCTGCGCTTTGAGGAAGCCCCGGATTACATGTATCTGAGGCAGCTATTCCGCATTCTTTTCAGGACCCTGAACCACCAATATGACTACACATTTGATTGGACAATGTTAAAGCAGAAAGCAGCACAGCAGGCAGCCTCTTCAAGTGGGCAGGGTCAGCAGGCCCAAACCCCCACAGGCAAGCAAACTGACAAAACCAAGAGTAACATGAAAGGTTAGTAGCCAAGAACCAAGTGACGTTACAGGGAAAAAAAATTGAACACAAAATTGGGTAATTCATTCATTTCTAACAGTGTTAGATCGAGGAGGTGG