Transcript asmbl_8050

Sequence
Transcript Sequence for observation asmbl_8050 of TGE0014537:
CCGGGGCTAGCGCCCGAGTTCCCTTTCCCAGAGTCCTCTGCGCCGTGAAGAAGCGGCTCCCGGGGACCGGGGGCATTTTGCGTTGGCTGGAGCCGGAGTAACAAGATGGCGGCGTCGGCGGAGTGACAGGGGTCCCTCCGGGAGGGAGCCGGCAGCAGTGGTGGCAGCGGGATCGCCGCCCTAACTCACCGCGCCCCTTTTCCAGCCCGCGACGTCGCCGCGAAAGCGAGGCAGCAGCGGCCGCCCAGACACAAGTGGCCCAGCCTGGTAACCGCGAGGACCCCTCACACACTGCGGCCTGGCGAGAAGAAACCTGCCTGAGCGGCGGTGATCAGGTTCCCCTCGGCTGATTCCGGGCCTGGTAACGCCGAGCCAACGCTTTCAGCTTCCTGCCGCCCTCCTCCGCAGCCTTGCTCCGGGGACGAGCCCAGAGGCCTCCGTCCTCCTCTCAGAGGTGTCGGGGCTCGGCCCCAGCCCCCGTCTGCGCCTCTCAGGATGGCGAGCAGCAGCGGCTCCAAAGCCGAATTCATTGTCGGAGGGAAATATAAACTGGTACGGAAGATCGGGTCTGGCTCCTTCGGGGACATTTACCTGGCGATCAACATCACCAATGGCGAGGAAGTGGCAGTGAAGCTAGAATCTCAGAAGGCCAGGCATCCCCAGTTGCTGTACGAGAGCAAACTCTATAAAATTCTTCAGGGTGGGGTTGGCATCCCCCACATACGGTGGTATGGTCAGGAAAAAGACTACAATGTGCTAGTCATGGATCTTCTTGGACCCAGCCTTGAAGACCTCTTCAATTTCTGTTCGAGAAGGTTCACAATGAAAACTGTACTTATGTTAGCTGACCAGATGATCAGTAGAATTGAATATGTGCATACAAAGAATTTTATACACAGAGACATTAAACCAGATAACTTCCTAATGGGTATTGGGCGTCACTGTAATAAGTTATTCCTTATTGATTTTGGTTTGGCCAAAAAGTACAGAGACAACAGGACAAGGCAACACATACCATACAGAGAAGATAAAAATCTCACTGGCACTGCCCGATATGCTAGCATCAATGCACATCTTGGTATTGAACAGAGTCGCCGAGATGACATGGAATCATTAGGATATGTTTTGATGTATTTTAATAGAACCAGCCTGCCATGGCAAGGACTAAAGGCTGCAACAAAGAAACAAAAATATGAAAAGATTAGTGAAAAGAAGATGTCCACTCCTGTTGAAGTTTTATGTAAGGGGTTTCCTGCAGAATTTGCCATGTACTTAAACTATTGTCGTGGGCTGCGCTTTGAGGAAGCCCCGGATTACATGTATCTGAGGCAGCTATTCCGCATTCTTTTCAGGACCCTGAACCACCAATATGACTACACATTTGATTGGACAATGTTAAAGCAGAAAGCAGCACAGCAGGCAGCCTCTTCAAGTGGGCAGGGTCAGCAGGCCCAAACCCCCACAGGCAAGCAAACTGACAAAACCAAGAGTAACATGAAAGGAACAAAGGAATCCATTTCTTATTTTAACTGTTGTTGCAGTGAAGATGGGTTTTTGGACTTTTAGAAGCCAGGAGATACCACCTAAAGTTCAAGATAAAAACCAAGGACTAATGCACACTGGAGAGAAGAATGCTTGCTTAGCACTTGAAGACCGAATGTCGAAATCATGCTGAATGCTTCTATTGTGATTTTTAACATCACTGACATCTTAGGATAATTCACTGGAGAAACATTGATCCCTGGGTGTGGAGTATCATAGCACACTGGACGATCTGAAGAATAAAATCTGGATTCGGCTGCTGTATTCTGCCAGGAATATCGTTAGGCTAGCCTTTAACCAGTCCGTAAACAATTGTAAATCATTAGTTGACTCAGCAATTCCTCAAATATCAGATTAAAGATGAACAGATAAAATTCTTACCTAGGTATAATTCTTATCCCTACACAACAGATTTCTACTATTTTGACTGCCAGTGTAACTTATATTTCCACATTTTAGTTTGTTAGTGACAGTGGTTTCCATTTTAAAGCTATTTGGATATTCAGTG