Transcript asmbl_69992

Sequence
Transcript Sequence for observation asmbl_69992 of TGE0007600:
GCTGAGTGGTTTTTCGGAACATGTCTGGTGGCTCCGCGGATTATAACAGAGAACATGGCGGCCCAGAGGGAATGGACCCCGATGGTGTCATCGAGAGCAACTGGAATGAAATTGTTGATAACTTTGACGATATGAACTTAAAGGAGTCTCTACTACGGGGCATCTATGCTTATGGTTTTGAGAAGCCTTCAGCTATTCAGCAGAGAGCTATTATTCCTTGTATTAAAGGGTATGATGTGATTGCTCAAGCTCAGTCAGGTACTGGCAAGACAGCCACATTTGCTATTTCCATCCTGCAACAGTTGGAGATTGAGTTCAAGGAGACCCAAGCACTAGTATTGGCCCCCACCAGAGAACTGGCTCAACAGATCCAAAAGGTAATTCTGGCACTTGGAGACTACATGGGAGCAACTTGTCATGCCTGCATTGGTGGAACCAATGTTCGAAATGAAATGCAAAAACTGCAGGCTGAAGCACCACATATTGTTGTTGGTACACCAGGGAGAGTGTTTGATATGTTAAACAGAAGATATCTTTCTCCAAAATGGATCAAAATGTTTGTTTTGGATGAAGCAGATGAAATGTTGAGCCGAGGATTTAAGGATCAAATCTACGAGATTTTCCAAAAATTAAATACAAGTATTCAGGTGAGCTTTTATTTTTCTTCTGTAGCTGGAGATTAGGTTTATGCAGGTACTGTTAGAATACAACTGAAGTGTTCTATTGTCGTTTCCTCTGTTTAAAGTAATTGATGCATAACTGCCTGTCTACTGCAATTCCTTAGCAAGACAGAGACTCTTGGTCTCAAACACGTAGAGTATTGTGATGGTTGTGCTAATTAACTGCTTGTGTGACATCATCATCATTGTCCTTTTAAGGTTGTGTTGCTTTCTGCCACT