Transcript asmbl_69969

Sequence
Transcript Sequence for observation asmbl_69969 of TGE0007598:
CTCTGGGATGCAATAGTTCGGGGCGGAAGTTAGAAAGCCCCGAGAGCGAGGCGACGGAAGTGGCCCCTTTACTGTTTGTCCGTGCGCAGGCGTTATTCTATTCTCTTGCTGCTGCTCTTCAGGCGCTTCTTTTCCCTCTCTTCTCTCTTCTCCACGCGAGGGGGTGCGCGTACCCTTAGTCGTGGTCGCGCACTCAGCCCCTGTGCTACTCTCGTGGCACTTTCATCATGGCGGGCATCCTGTTTGAGGATATTTTTGATGTAAAAGACATTGACCCGGAGGGCAAGAAGTTTGACCGAGTGTCTCGACTGCATTGTGAGAGCGAATCTTTCAAGATGGACCTTATCTTAGATGTAAACATTCAGATTTACCCTGTAGACTTGGGTGACAAGTTCCGGTTGGTCATAGCCAGTACCTTGTATGAAGATGGTACCCTGGATGATGGTGAATACAACCCCACAGATGACAGACCTTCCAGGGCTGACCAATTTGAGTATGTAATGTATGGGAAAGTGTACAGGATTGAGGGAGACGAAACTTCTACTGAAGCAGCAACACGTCTCTCTGCCTACGTCTCGTATGGGGGCCTGCTCATGAGGTTGCAGGGTGATGCCAATAACCTGCATGGATTTGAAGTGGATTCCAGAGTTTATCTGCTGATGAAGAAACTGGCCTTCTGAACCACCTGGGAAGCCAATCTTGCTGCTTAGTCACTTAGGTCATGGACATTCATTCAAGTCTGAGCAGCAGTTGCTGTTGTTCACCTGTCTAAGAGGGGCTGGATTTGTGTTGATTGTGCCGTGCATCTTTAGGTGGTGTCTGAACTCAATGGGAAGTTGACTTGCTTGTGAAAGACCCAGTGGGAGGGCTTAAAAGGAATAAGAAGTTGTTGTGTGTATATGATTTTTTAAATTAAACTTTACTTTCTCAGACTTTCTTCCCTTAAAATATATATTTTTTTCTGTTTACTTTAAAATCA