Transcript asmbl_693

Sequence
Transcript Sequence for observation asmbl_693 of TGE0007654:
TGGGAGTCAACTTTAAAGTCGTTGTCGCCGCACCCCGGACGTCCCGCTGACCGCGTGCGTGCTTCTGAGAAATGTCTACCAACGAGACAGAAGCCCCTGCCAACACCCATGTGACAGCAGAAGAACCGGTACAGCAGCCCAGCGTGGTGGACCGCGTGGCCCACATGCCCCTTATCGGTGCCACCTGTAATATGGTGTCCGCGGCCTACACCTCCACCAAGGAGAGCCACCCCCACGTCAAGACCGTCTGCGAAGCGGCGGAAAAAGGTGTGAAGACCCTCACAGAGGCTGCCATCAGCGGGGCCCAGCCCATCCTGTCCAAGCTGGAGCCTCAGATCGCATTGGCCAGTGAATACGCCCACAAGGGGCTGGATAAGCTGGAGGAGAACCTGCCCATCCTGCAGCAGCAGACGGAGAAGGTCCTGGCAGACACCAAGGAACTCGTGTCATCTAAGGTATCGGGGGCCCGAGACGCCATGTCCAGCACGGTGTCCAGCGCCAAGGACGCAGTGGCCGCCCGAGCGACAGGGGCAGCAGATGCGACCCGGGAAGCCATGCAGAGTGGCGTGGACATGACCAAGTCGGTGGTGACCAACAGTGTCCAGTTGGTGGGCCAGATGGTGCTGAGCGGGGTGGATACGGTGCTGGGCAAGTCGGAGGAGTGGGCGGACAACCACCTGCCCATGACGGACTCCGAGCTGGGTGAGTGTGGCCCGCGGGCCAGCCCCCACCCCGACACCCCCACGCAGAGTCCGTCGGTTTGAATGACATTTAAATGAACAAATAAATGGCCGGTGGGTGAGGGGAAGAACA