Transcript asmbl_59620

Sequence
Transcript Sequence for observation asmbl_59620 of TGE0003191:
TCCTTCCGGGGTTTTGGGCTGGAACTGCAGCGCTTAGAGAGCTCGGTGGAAGCTGCTAAAGGCGGAGGCGGGGCTCTGGCGAGTTCTCCTTCCACCTTCCCCCACCCTTCTCTGCCAACCGCTGTTTCAGCCCCTAGCTGGATTCCAGCCATTGCTGCAGCTGCTCCACAGCCCTTTTCAGGACCCAAACAACCGCAGCCGCTGTTCCCAGGATGGTGATCCGTGTATATATTGCATCTTCCTCTGGCTCTACAGCGATTAAGAAGAAACAACAAGATGTGCTTGGTTTCCTAGAAGCCAACAAAATAGGATTTGAAGAAAAAGATATTGCAGCCAATGAAGAGAATCGGAAGTGGATGAGAGAAAATGTACCTGAAAATAGTCGACCAGCCACAGGTTACCCCCTGCCACCTCAGATTTTCAATGAAAGCCAGTATCGCGGGGACTATGATGCCTTCTTTGAAGCCAGAGAAAATAATGCAGTGTATGCCTTCTTAGGCTTGACAGCCCCACCTGGTTCAAAGGAAGCAGAAGTGCAAGCAAAGCAGCAAGCATGAACCTTAAGCACTGTGCTTTAAGCATCCTGAAAAATGAGTCTCCATTGCTTTTATAAAATAGCAGAATTAGCTTTGCTTCAAAAGAAATAGGCTTAATGTTGAAATAATAGATTAGTTGGGTTTTCACATGCAAACATTCAAAATGAATACAAAATTAAAATTTGAACATTATGGTGATTATGGTGAGGAGAATGGGATATTAACATAAAATTATATTAATAAGTAGATATCGTAGAAATAGTGTTGTTACCTGCCAAGCCATCCTGTATACACCAATGATTTTACAAAGAAAACACCCTTCCCTCCTTCTGCCATTACTATGGCAACTTAAGTGTATCTGCAGCTCTACATTAAAAAGGAGAAAGAGAAATAACCTGTCTCTCATTCCTAAGTTGCCTCATTAATTTTCATGAACAAGAATATGTACCTTTTTGATGCTATATTACTGCGATTAAAAAGTTCTTGCAGGTAATGTTTATGATATGTTAAACGTTGTAATTTCCTATCGTAATTATAACATTCCCATTCTTTTGTAGATGAAACTTCTACATATTGAACCACAGATTTTCTGAGCTTCTAAATGTAGCCTTTCATTGCACATTTCAGTGATCAGAATAGATATCCTTTTACACGCACAAAAGCAATAGATTCATTCAGTGGACAAGTTCCTTGTTTAACTACACAGCTATGATGGAATGATATATCCAAGTTCCTTGCCTCAGTGAAATATGCATATGTATATCATGAAAGTGGGATGCCAAGTAAGCTTAAAATGGCATTCTCTAGCAAAGAGATTAGACTTTTAAATAACTCTTATAAAACAGGTTGGCGATCATTTCCCAAGATTGGTTTCCCTTGAGTTTTTGCTAAAACAAATCTTAGTAGTTTTGCCCGTTTAAAACAACTCACAATCGTAAATGCTACTATTCCTAAGATATCTTACCTTTTTATTTCAGTTTAGCCATGTATTGTATGAGTGTATTAGTCTAAGCAGTGAGAATCTTTTCTATGCCTCTATTCCAGCAAAAAGTAGAAGTATCAAATAAAAAGGGCAACTTTTAAAATATTAAGCCTGAAGACTTCTAAAAAGACAAGAAACATGGCCTAAATAACCAACATAGATTTACATAGTAAGTTTCACACTACCTTATTACCAAAAGCAAACACCTCTTACTTTAAACTACATTATCATGTATATCTATTGTATGCTGGTCTTTACTTTTTGCCAAAATCAACATATAATGAAGAGATGCCTTTGTTTCATGAGATTCAAACTTGATGCTATGCTTTAAAATAAACTCAGTACTTT