Transcript asmbl_68063

Sequence
Transcript Sequence for observation asmbl_68063 of TGE0007455:
GTTCAACAGTAGAGGTAGAGCTACTTGTTAAATTCTGACAAGTATTGGAAGTACAGAATGCCAGGCCAGAAACTGTCACTAATGATGATGAAGAAGCCTTAGATGAAGAAACTAAGAGAAGAGATCAAATGATCAAAGGGGCCATTGAAGTTTTAATACGAGAATACTCCAGCGAGCTCAATGCCCCTTCACAAGAATCTGACTCTCATCCCAGGAAGAAGAAAAAGGAAAAGAAGGAGGACATTTTCCGCAGATTTCCGGTGGCACCACTGATCCCTTATCCGCTCATCACTAAGGAGGATATAAATGCTATAGAAATGGAAGAAGACAAAAGAGACCTGATATCCCGAGAAATCAGCAAATTCAGAGACACACACAAGAAACTGGAAGAAGAGAAAGGCAAAAAAGAAAAAGAAAGACAGGAAATTGAGAAAGAACGGAGAGAAAGAGAGAGGGAGCGTGAAAGGGAACGAGAAAGGCGAGAACGGGAACGAGAAAGAAAAACGTGAACGAGAAGGAGAAGGAACGGGAGCGGGAACGAGAACGGGATAGGGATCGTGACCGGACAAAGGAGAGAGATCGAGATCGGGATCGAGAGAGAGATCGGGACCGCGATCGTGAGAGGAGCTCAGATCGAAATAAGGATCGGAGTCGATCTAGAGAAAAGAGCAGAGATCGTGAAAGGGAACGAGAGCGAGAAAGAGAAAGAGAGCGAGAACGAGAACGAGAGAGAGAACGTGAGCGAGAGAGAGAGCGAGAAAGGGAACGAGAGCGTGAGAGAGAGAAAGACAAGAAGAGAGACCGAGAAGAGGATGAAGAAGATGCATATGAACGAAGAAAACTTGAAAGAAAACTTCGAGAGAAAGAAGCTGCTTATCAAGAGCGCCTTAAGAATTGGGAAATTAGAGAACGGAAGAAAACCCGGGAGTATGAGAAAGAGGCTGAAAGAGAAGAAGAAAGAAGAAGAGAAATGGCAAAAGAAGCTAAACGACTAAAAGAATTCTTAGAGGATTATGATGATGATAGAGATGATCCCAAATATTACAGAGGAAGTGCTCTTCAGAAAAGATTGCGTGATAGGGAAAAGGAAATGGAAGCAGATGAACGGGATAGGAAAAGAGAGAAGGAAGAGCTAGAGGAAATCAGGCAGCGCCTTCTGGCAGAAGGGCACCCGGATCCAGATGCAGAGCTCCAGAGGATGGAACAAGAGGCTGAGAGGCGCAGACAACCACAAATAAAGCAAGAACCAGAATCTGAGGAAGAAGAAGAAGAAAAACAAGAAAAAGAGGAAAAACGAGAAGAACCCATGGAAGAGGAAGAAGAGCCAGAGCAGAAACCCTGTCTCAAACCAACTCTGAGGCCCATCAGTTCTGCTCCATCTGTTTCCTCTGCCAGTGGCAATGCAACCCCCAACACTCCTGGGGATGAGTCTCCCTGTGGTATTATTATTCCTCACGAAAATTCGCCAGATCAACAACAACCTGAGGAGCATAGGCCAAAAATAGGACTAAGTCTTAAACTGGGTGCTTCCAATAGTCCTGGTCAGCCTAATTCTGTGAAGAGAAAGAAACTCCCCGTAGATAGTGTCTTTAACAAATTTGAGGATGAAGACAGTGATGATGTACCCCGAAAAAGGAAACTGGTTCCCTTGGATTATGGTGAAGATGATAAAAATGCTGCCAAAGGCACTGTAAACACTGAAGAAAAGCGCAAACATATTAAGAGTCTCATTGAGAAAATCCCCACAGCCAAACCAGAGCTCTTTGCATATCCCCTGGATTGGTCTATTGTGGATTCTATATTGATGGAACGACGAATTAGACCATGGATTAATAAGAAAATTATAGAATACATAGGTGAAGAAGAAGCTACATTAGTTGATTTTGTTTGTTCTAAGGTTATGGCTCATAGTTCACCTCAGAGCATTTTAGATGATGTTGCCATGGTACTTGATGAAGAAGCAGAAGTTTTTATAGTCAAAATGTGGAGATTATTGATATATGAAACAGAAGCCAAGAAAATTGGTCTTGTGAAGTAAAACTCTCTTTACACTTAAGAGTTCCATTTCAGATACCATCTTTCCCATCCTTCAAAGGACTTTGAATTTTTCTTTGTCTTCAAAGACATTTGCAAGATCTGTAATTTTTTTTTAATGTAGAAAATGTGAATTTTTTTTGTCCTCCAATTCGTTGATGCCTTGTGTACTCTCTTGGTTGTAAAGACATCTGAATCCTACTTTGGTTCTCTTTATACTCACCAGGTACAAATTACTGGTATGTTTTATAAGCCGCAGCTACTGTACACAGCCTATCTGATATAATCTTGTTCTGCTGATTTGTTCCTTGTAAATATTAAAATGACTCCCCAATTCTTTTGCAGAATTGCACTTAATATTGAACTGTACTGTAAAGGAACCAACACGAACAATTTTAATTGAAAGAATACCAGTCCTTCCTTCCCTATTTGATCAGAATTGGCAAGCTTTCATGAAGGCATGAAATTAATTTTTGAAATTAGAGTGCGAAAATTAGCAGACCATCCATTCCTACTGTATCTGTATGAATGTGTTTGTGTGAATGTATATATAAAAGTGTTACTTTGCCCTGATTTGCTTTGGAGGGCTCCCGTAAACATTTCCTAACTGAAGAATAGAATCGTAAAGGAAACGTGGTGTTGTGCCAACCCAAATGTCTGGGATAATTAGGTTATTAGTCTCCCAGAGCATGGTATTCTTTTCTGGCAAGCAACAGTCTGTTGAATAGCATGGGGTTCTCCTGTTGATAGCTGGCTGCTTCAGCCTCTCTTTTTAAGGGACTGTGAATCACTGATCCCCTGCCCCTCAATTTCATTGTGCAGAGATGAGTCAGATCCTTAGATTCTGGAGAGCTTTATTTAATGCATTTTTGCACTAATTGGTCTTTAGCTTAATTTTGGTGTACCCCTTTTGTTGGGAAAAAAATGGAAAAGCATAAATGAGGGAAAAAAAACTTGAGAAACAAAAGATAAAATTAGGCCATTTGACAGACTAGGAAAATTTGACAAAATATACTAGGAATTCAGCATGGCATTTTACGTTTACATCTTATTTCTAAGGATAAAGTAAATCATTTAAGGCAGTTACCACTAATTTTTTGTTTTTGTTTTGATAAAGGGTTTATAGCTTGTGCTTGTGTATATACACACACACTTTGTTTACCTCTGCTCATCAAAGTTTGAAAATATACTGATGTTGTTAGAGACATACATTTCTTTATTGTAGATCAGAACTTCACCAGGGAGCAAAATTACCTGAAAACGTAACGAGTTTTAAACAGTTCTTAACAGAGTAGGTGTGGCTATTACCATGTCTGAGTATTTATTTAAAAGAAAAATAAAGATTTGGTGGCGGTGGGGGGATGTTAAAAAGCATAACTGAGCTTGAGTTATTAGATTTTTTTACATCTTAAAGAGGACATTTGAAAACACTGTTCTTAATATTGGACCATGACATGGTTCTATTATGTAAATATTTCAAATATTAAAAATGTATATATTTGATCTTGGGGACTCATTCTTTCAGAGTCTTATTAAATAAATGGCATCATGCTGTAATTGTGCAGTGCATACTAGAAACTTAACTTGAAAATATGGGCTAAATTAATTTTTATGAATATTAGTGACTGAAGGGCAAAGAGGATATTACCTAATTTTAGATTACTCTATATGTCTATGGAGATATCTCCTTTTAGTGTTATAATATAAATTCTGGTTTCTCAAGGGAAAATTTCAGAAACATGCTCCTTGCCATTTACAAATTAA