Transcript asmbl_66253

Sequence
Transcript Sequence for observation asmbl_66253 of TGE0007406:
TTGGGAGGCGGGGCGCGCGCGGGGGGGTACCCCTCCCTTCGGTCCTCCTTGCGGTGGACGGGTCTGCCTGCCCAGATCCGCCGCCCAGCGAGGATCCAAGGCATCTGTGCGGCCCGGGGGGCTCGGCCGGGACAAGCTAGGGGCACGGTGCCCGGGGCGGGTGGGCGGTGACCCGACGCAGGGCAAGCGGAAGAATAGATTCGCGGACCTCCGAGGGGAACCTGAGAGTGCAGACCTTGAGCGGACGTGAAACCGGCGCGGTCCGGGGGCCGGGAACTGCTCAGCGCTGCAGGGCTCCACGGCGCTGCCCGCCCGCGCGTTTCCAGGGGCGCGGGGAGCAGGTGAACAGGTCCTCGCTCACAGCTCCACGCCCTCACGCGCTCTCGCCCCGGCCTCCGCTCCCGCTTGCAGCCATGGGCCCGGGTCTCCGCCTCGCCACCCGCGTCCCACGCCAGATGCTTTGCGCGCTGGCCTTGATGGTGGCCGCTGGCGGCCGCATTGCCTCTGCTTTCAACCTGGACACCCAATTCCTGGTGGTGAAGGAGGCCAGGAACCCGGGCAGCCTCTTCGGCTACTCGGTCGCCCTCCATCGGCAGACGGAGCGGCGGCGGCGCTACCTGCTCCTGGCTGGTGCCCCCCGGGATCTTGCTGTGCCTGATGGCTATACCAACCGGACTGGTGCTGTGTACCTGTGCCCACTCACTGCCAACAAGGACGACTGTGAGCGGATGGACATCGGAGAGAAAAGTGACCCTGACCATCACATAATTGAGGACATGTGGCTGGGGGTGACTGTGGCCAGCCAGGGCCCTGCAGGCAGAGTCCTGGTCTGTGCCCACCGCTACACCCAGGTGCTGTGGTCGGGGCTGGAGGACCAGCGGCGCATGGTGGGCAAGTGCTATGTGCGGGGCAATGACCTAGAGCTGGACCGCACTGATGACTGGCAGACCTACCACAACGAGATGTGCAACAGCAACACTGACTACCTGGAGACGGGCATGTGTCAGCTGGGCACCAGTGGCGGCTTTACCAAGAACACTGTGTACTTCGGTGCTCCCGGTGCCTACAATTGGAAAGGAAACAGTTACATGATTCAGCGGAAGGACTGGGATTTATCTGAATACAGTTACAAGGGCCCAGAGGACCAAGGAAACCTCTATATTGGGTACACAGTGCAGGTGGGCAGTGCCATCCTGCACCCCACGGATATCACCATTGTGACAGGTGCCCCACGGCACCAACATATGGGCGCTGTCTTCTTGCTGAGCCAGGAGGTAGGCGGAGACCTGCGGAGGAGGCAGGTGCTGGAGGGCACACAGGTGGGCGCCTATTTTGGCGGTGCCATTGCCCTGGCAGACCTGAACAATGATGGGTGGCAGGATCTCCTGGTGGGTGCCCCCTACTACTTTGAGCGGAAAAAGGAGGTAGGGGGTGCCATCTATGTCTTCATGAACCAGGCAGGCACCTCCTTCCCTGCCCACCCCTCCCTCCTTCTTCACGGTCCTAGTCACTCTGCCTTTGGCTTCTCCGTGGCCAGCATTGGTGACATCAACCAGGATGGATTCCAGGACATTGCTGTGGGAGCTCCATTTGAAGGCTTGGGAACAGTGTACATCTATCACAGCAGCTCCAGGGGGCTTCTCCAACAGCCCCAACAGATAATCCACGGAGAGAAGTTGAGACTACCTGGCTTGGCCACCTTTGGCTACTCCCTGAGTGGGCGGATGGATGTGGATGAGAACTCCTACCCGGACCTGCTAGTGGGGAGCCTTTCAGACCGCATCGTGCTCCTGAGGGCGCGGCCTGTCATCAACATCCTCTATAAGACCTTGGTGGCCAGGCCTTCGGTGCTGGACCCCACACTCTGCACAGACACCTCTTGTGTGCAGGTGGAGCTGTGCTTTGCTTATAACCAGAGTGCTGGGAACCCCAACTACAGGCAAAATATCACCCTGGCCTATACACTGGAGGCTGACCGGGACCGCCGCCCACCCCGACTTCGCTTTGCACAGAGCCAGTCAGCTGTCTTTCATGGCTTCTTCTCCATGCCCGAGATGCGCTGCCAGACGTTGGAGCTGCTCCTGATGGACAACGTCCGTGACAAACTCCGTCCCATCGTCATCTCCATGAACTACTCTTTATCTTTGCGTATGCCGGAGCGCCCCAGGCTGGCGCTGCAGTCCCTGGACGCCTACCCGGTCCTCAACCAGGCGCAGGCTCTGGAAAACCACACTGAGGTCCAGTTCCAGAAGGAGTGTGGGCCGGACAACAAGTGCGACAGCAACTTGGAGATGCAGGCAGCCTTCGTGTCCGAGCAGGGGCAGCCGATGAGCAGGCTCCAGTACAGCAGAGACTTTGGGAAACTGCTCTTGAGCATCAATGTGACTAATATCCGGAGCAGGCAGCGGGCTGGAGAAGATGCCCACGAGGCGCAGCTCACCCTGGCGGTACCTCCCGCCCTGCTACCGTCCTCAGTGCGCCCTTTTGGGGCCTGCCAGGGCAACGAGACTATCCTTTGCCACCTGGGGAACCCCTTCAAACGGAACCAGCGGATGGAGCTACTCATCGTCTTTGAGGTCATCGGGGTGACCCTGCACACAAGGGAGCTCCAGGTGCAGCTGCAGCTGTCCACGTCAAGTCACCAGGACAATCTGCAGCCCATGACCCTGACTCTACTGGTGGATTACATGCTCCAGGCCTCACTCAGCATGGTGAGTCACCGGCTACAAAGCTACTTTGGGGGAACAGTGATGGGTGAGTCTGGCATGAAAACTGTGGAGGATGTGGGGAGCCCTCTCAAGTATGAGTTCCAGGTGAGCCCAATGGGGGAAGGGCTGGCAGCCCTGGGCACCCTGGTCCTAGGACTGGAGTGGCCCTACGAAGTCATCAATGGCAAGTGGCTGCTGTACCCTACAGAGATCACCATCCGCGGCAATGGGTCCTGGCCCTGCCAGCCACCCGGAGACCTTGTCAACCCTCTCAACCTCACTCTCTCTGTCCCTGGGGATAGGCTGCCAACTTCACAGCGTAGGCGAAGACAGCTTGACCCAGGGGGAGGCCAGGGCCCCCCACCTGCTACTCTGGCTGCTGCCAAAAAAGCCAAGTCTGAGACCCTGCTGAGCTGTGGCAGTGACCACACCCGCTGCGTGTGGCTGGAGTGCCCTATTCCTGATGCCCCTGTCATCACCAATGTGACTGTGCAGGCTCGAGTGTGGAACAGCACCTTTATTGAGGATTACAGGGACTTTGACCGAGTCAGGGTAACCAGCTGGGCTACCCTGTTCCTCCGAACCAGCATCCCCACCATTAACATGGAGAACAAGACCGTGCCGTTCTCTGTGGACATTGACTCTGAGCTGGTGGAGGAGCTTCCAGCTGAGATCGAGCTGTGGTTGGTGCTCGTGGCTGTAGGTGCCGGGCTGCTGCTGCTGGGGCTCATCATCCTCCTGCTATGGAAGTGCGGCTTCTTCAAGCGAGCCCGCACTCGCGCCCTGTATGAAGCCAAGAGACAGAAGGCGGAGATGAAGAGCCAGCCGTCAGAAACAGAGAGGCTGACCGAAGACTACTGAAGGGGGCGGCCCCTGCCCCCAACCCACCCGGTGTGACTTCTTTAAACGGACCCACTATTACCAGATCATGCCTAAGTACCACGCGGTGCGGATCCGGGAGGAGGAGCGCTACCCACCTCCAGGGGAGACCCTGCCCACGAAGAAGCACTGGGTGACCAGCTGGCACACTCGGGACCGATACTACTGACATCCTCCCTGATCCCACCCCCGTGCCCCCAGTGTCCCCTTCTATTTATCATAAGTTATGCCCTGACAGTCCACAGGGGCCACTGCCTTTGGCTGGCGCCAGCAGGCTCAGGCACACACACCTCTTCGAGCGCATACATGTGTCGTCTGGCCACAGACTTCTCCGCGCAGGAGTGCTGGGACCGTGGACCTTGCTCTGCCAAGCACACCACAGACCTGTGCCCTGGACACATGTGGATACATGTGGGTCCCACTGTGCTTGTGCACCACAGATGGTTTATGGACATGTGTGTCCCAGCCTCTGCTAGAGCCAGGAGGAAAAGGCTCCCAATGTGGTGACACCTTTCTTGTTCACACTGGACCCATCTTGAGCCATAGTCACTGGATGGACTCTGCTCTCAAGATTAAAACTACTGACAGGG