Transcript asmbl_66222

Sequence
Transcript Sequence for observation asmbl_66222 of TGE0023051:
CAATTTGCTACCTGGTTCGAAGAGGCTGTTCAGTGTCCTGACATAGGAGAAGCCAACGCCATGTGTCTGGCTACCTCCACCAGAGATGGGAAGCCCTCTGCCCGCATGGTGCTGCTGAAGGGCTTTGGCAAGGATGGCTTCCGCTTCTTCACTAACTTTGACAGTCGAAAGGGAAAAGAGCTGGACTCTAATCCCTTTGCTTCCCTTGTCTTCTACTGGGAGCCCCTAAACCGTCAGGTCCGTGTGGAGGGCCCTGTGAAGAAGCTGCCGGAGGAGGAGGCCACGTGCTACTTCCACTCCCGCCCCAAGAGCAGCCAGATTGGGGCTGTGGTCAGTCACCAGAGTTCTGTGATCCCCAGCCGGGAGTATCTGAGAAAGAAAAATGAGGAACTGGAGAAGCTCTACCAGGAACAAGAGGTGCCGAAGCCGAAATACTGGGGTGGCTACATCCTGTACCCACAGGTGATAGAGTTCTGGCAAGGCCAAACCAACCGCCTGCACGACCGGATCGTCTTTCGGCGGGGCCTCCCGACTGGAGACTCTCCTTTGGGGCCCATGACCCACCGCGGGGAGGGAGATTGGCTTTTTGAGAGACTTGCACCCTGACTCCCAATCCGCCAGTGCCTGCTGGAGTTGGGGCTGGGTGCTGGGAGAGGGTGTGGAATCGGGAGCCGGGCCCTTCTAAACTCAACCCATATTCCTCCCCACCCCTTATATTCAGGGCTCTTCAGGGTTCATCCTCCAAGTTCTCTCTACTCAGTTGGCTCTCAATTAGCTGTCTAGTGACGTGTACTGGTGGCATGGGG