Transcript asmbl_66175

Sequence
Transcript Sequence for observation asmbl_66175 of TGE0007389:
GGAAGTTTCAAACCCGACTGGAGTTGCTCTCGTAACGGACGAGCGTCTGTGGAGAAGCGGCTTTCTCTCTTATTGTCTCGTGGGCCCCGCTGGTTTAGTTGCTTGCAGGGTTCTCGAGCCCTTTCACGACCGTCACCATGGAGGTGTCACCACTGCAGCCTGTAAATGAAAATATGCAAATCAACAAAACAAAGAAAAATGAAGATGCTAAGAAAAGACTGTCTATTGAAAGAATCTATCAAAAGAAAACACAGTTGGAACACATTTTGCTCCGTCCAGACACTTACATTGGCTCTGTGGAATTAGTGACCCAGCAAATGTGGGTTTACGATGAAGATATTGGCATTAACTATAGGGAAGTCACTTTCGTTCCTGGTTTATACAAAATCTTTGATGAGATTCTAGTCAATGCTGCAGACAACAAACAAAGAGACCCAAAAATGTCTTGTATTAGAGTCACAATTGACCCGGAAAACAATTTAATTAGTATATGGAATAATGGAAAAGGTATTCCTGTTGTTGAACACAAAGTTGAGAAGATGTATGTCCCAGCTCTCATCTTTGGACAGCTCCTAACTTCTAGTAACTATGATGATGATGAAAAGAAAGTAACAGGTGGTCGAAATGGCTATGGAGCCAAATTGTGTAACATATTTAGTACCAAATTTACTGTGGAAACAGCCAGTAGAGAATACAAGAAAATGTTCAAACAGACGTGGATGGATAACATGGGGAGAGCTGGTGAGATGGAACTCAAGCCCTTTAATGGAGAAGATTATACATGTATTACCTTCCAGCCTGATTTGTCTAAGTTTAAAATGCAGAGCCTTGACAAAGATATTGTTGCACTGATGGTTAGAAGAGCATATGATATTGCTGGATCCACTAAAGATGTCAAAGTCTTTCTCAATGGAAATAAGTTGCCAGTGAAAGGATTCCGTAGCTATGTGGATATGTATTTGAAGGATAAAGTAGATGAAACTGGCAATCCATTGAAAATCATCCACGAACAAGTAAACCACAGGTGGGAAGTGTGTTTAACAATGAGTGAAAAAGGCTTTCAGCAAATTAGCTTTGTCAACAGCATTGCTACTTCCAAGGGTGGCAGACATGTTGATTATGTAGCTGATCAGATTGTGACTAAACTTGTTGATGTTGTGAAGAAGAAGAACAAGGGCGGTGTTGCAGTAAAAGCACATCAGGTGAAAAATCACATGTGGATTTTTGTGAATGCCTTAATTGAAAACCCAACCTTTGACTCTCAGACAAAAGAAAACATGACTTTACAAGTCAAGAACTTTGGATCAACATGCCAACTAAGTGAAAAATTCATCAAAGCTGCAATTGGCTGTGGTATTGTAGAAAGCATACTAAACTGGGTGAAGTTTAAGGCTCAAATCCAGTTAAACAAGAAGTGTTCCGCTGTGAAACATAACAGAATCAAGGGTATTCCCAAACTTGATGATGCCAATGATGCAGGGGGCCGAAACTCCACTGAGTGTACACTTATCCTGACCGAGGGAGACTCAGCTAAAACTTTGGCTGTTTCAGGCCTTGGTGTGGTTGGGAGAGATAGATATGGGGTTTTCCCTCTTAGAGGAAAAATACTCAATGTTCGAGAAGCTTCTCATAAACAGATAATGGAAAATGCCGAAATTAACAATATCATCAAGATTGTGGGTCTTCAATACAAGAAAAACTATGAAGATGAAGATTCATTGAAGACTCTTCGTTATGGGAAGATAATGATTATGACAGATCAGGACCAAGACGGTTCCCATATCAAAGGCTTGCTGATTAATTTTATCCATCACAACTGGCCCTCTCTTCTGCGACATCGTTTTCTGGAGGAATTTATCACTCCCATTGTAAAGGTGTCTAAAAACAAGCAAGAAATGGCATTCTATAGTCTGCCTGAATTTGAAGAATGGAAGAGTTCTACACCAAATCATAAAAAATGGAAAGTCAAGTATTACAAAGGTTTGGGCACCAGCACATCAAAAGAAGCTAAAGAATACTTTGCAGATATGAAAAGACATCGTATCCAGTTCAAATATTCTGGTCCTGAAGATGATGCTGCAATCAGCCTGGCCTTTAGCAAAAAACAGATAGATGATCGAAAGGAATGGTTAACTCATTTCATGGAGGATAGAAGACAACGAAAGTTACTTGGCCTTCCTGAGGATTACTTGTATGGGCAAACAACCACATATCTGACCTACAATGACTTCATAAACAAGGAACTAATCCTGTTCTCAAATTCTGATAACGAGAGATCTATCCCGTCTATGGTGGATGGTTTGAAACCAGGTCAGAGAAAGGTTTTGTTTACGTGTTTCAAACGGAATGACAAGCGAGAGGTGAAGGTAGCCCAGTTAGCTGGGTCAGTGGCTGAGATGTCCTCTTATCATCATGGTGAGATGTCACTAATGATGACCATTATCAATTTGGCTCAGAATTTTGTGGGTAGCAATAATCTGAACCTCTTGCAGCCCATTGGTCAGTTTGGTACCAGGCTGCATGGTGGCAAGGATTCTGCTAGTCCTCGATACATCTTCACAATGCTCAGCCCTTTGGCTCGGTTGTTATTTCCACCACAAGATGATCACACATTAAAGTTCTTATATGATGACAACCAGCGTGTGGAGCCTGAGTGGTACATTCCTATTATACCCATGGTGCTGATAAATGGTGCTGAAGGAATTGGTACTGGGTGGTCCTGCAAAATTCCCAACTTTGATATTCGTGAAGTCGTGAATAATATCAGGCTTTTGATGGATGGAGAAGAACCTTTGCCAATGCTTCCCAGTTACAAGAACTTCAAGGGTACTATTGAAGAGCTGGCTCCAAATCAGTATGTGATTAGTGGTGAAGTGGCTATTCTTAATTCCACAACCATTGAAATCTCAGAGCTTCCCATCAGAACATGGACCCAGACATATAAAGAACAGGTTCTGGAACCAATGTTGAACGGCACAGAGAAGACACCTCCTCTTATAACAGATTATAGGGAATACCATACAGATACCACTGTGAAGTTTGTTGTGAAAATGACTGAAGAAAAACTGGCAGAGGCCGAGAGAGTGGGACTACACAAAGTCTTCAAACTCCAAACTAGTCTCACATGCAACTCTATGGTGCTTTTTGACCACGTAGGCTGTTTAAAGAAATATGACACAGCGTTGGATATTCTAAGAGACTTCTTTGAACTCAGGCTTAAATATTATGGATTAAGAAAAGAATGGCTTCTAGGAATGCTTGGCGCTGAATCTGCTAAACTGAACAATCAGGCTCGCTTCATCTTAGAGAAAATAGATGGCAAAATAATCATTGAAAATAAGCCTAAGAAAGAATTGATTAAAGTTTTGATTCAGAGAGGATATGATTCGGATCCTGTGAAAGCTTGGAAAGAAGCCCAGCAAAAGGTTCCAGATGAAGAAGAAAACGAAGAGAGCGATAATGAAAAGGAAACTGAAAAGAGTGACTCTGTAACTGGACCAACCTTCAACTACCTTCTTGATATGCCTCTTTGGTATCTTACCAAGGAAAAGAAAGATGAACTATGCAAATTAAGAAAGGAAAAAGAACAAGAGCTAGAAACATTAAAGAAAAAGAGTCCATCAGATTTGTGGAAAGAAGACTTGGCTGCTTTTATTGAAGAGCTGGAGACTGTTGAAGCCAAGGAAAAACAAGATGAACAAGTAGGACTTCCTGGGAAAGGGGGGAAAGGAAAAGGGAAAAAAACACAAATGGCTGAAGTTTTGCCTTCACCAAGTGGAAAAAGAGTCATTCCCCGAGTTACCATAGAGATGAAAGCAGAGGCAGAAAAGAAAATTAAAAGGAAAATTAAGAATGAAAATTCTGAAGGAACTCCTCAAGAGAATGGTATGGAACCCGAAAGCCTAAAACAAAGATTAGAGAAGAAACTGAAAAAAGAACCAGGTACCAAGACGAAGAAACAAACTACATTGCCATTTAAACCAGTCAAAAAAGGAAAGAAGAGAAACCCCTGGTCTGATTCAGAATCAGATGCGAGCAGTAACGAAAGTGATTTTGATGTCCCTCCACGAGAAATAGAGCCACGGAGAGCAGCAACAAAAACCAAATTCACAGTGGATTTAGATTCAGATGAAGATTTCTCAGATTTTGATCAAGAAACTCAAGATGAAGATTTTGTGCCATCTGATGCTAGTCCAGTTAAGACCAGAACTTCCCCGAAACGTGCTAACAAAGAACTGAAGCCACAGAAGAGCACCACGTCAGTAACGGACTTTGATGCTGATGATGCCAAGGACGATGTTCCACTTTCTCCAAGTTCTCCTGCTGCTGATTTCCCAGCCGAAACAGAAATTGTAAACCCTGTTTCTAAAAAGAACGTGACAGTGAAGAAGACGGCAGCAAAAAGTCAGTCTTCCACCTCGACTACAGGTGCCAAAAAAAGGGCTGCACCAAAAAGAACCAAAAAGGATCCAGGCGTGAATTCTGATGCCCCTCAAAAGCCTGATCCCCCCAAAACCAAGACTCGCCGCAAAAGAAAGCCATCCACTTCTGATGATTCCGACTCTAACTTTGAGAAAATGATTTCTAAAGCAGTCACAAGCAAGAAATCCAAGGGGGAGAGTGATGACTTCCACCTGGACTTAGACTCAGCTGTGGCTCCTCGTGTAAAATCTGGGCGGGCAAAGAAGCCGATAAAGTACCTTGAAGAATCAGATGAAGATGATCTGTTTTAAAATGTGAGGTGACTATTTTTAGTGGTCTTATTGAGCCCAAGACTGGTTTGAATCTCTTAATTTCCTCCCCTTTAAATTTAGTTTGGGGAAAGTAGTTTTGATCTAAAATCACCAAAGTGAAGTATGTAGAGCCCAGCGTCCCTTATCTTTTTATGATACAGTCTAAATGGTGATACATCTCATGGGCATTGTTTTTTTCTCTGCTTTGTCTGTATTTTCATTCTGTTTCCTTTTGTCTTTAAAATCTGATTTTAACTTCTGGACTCCAGAGATAGTTATGTGGTCATTCCAGCATAATGTAGTTTGTTTATTGACCATACATTAAGCTAAAATTGGAGCACTTTGATATAAAAGTGTCTACTGTGCCTCCTTTCTTACCTTCATAAATATGAGATAGAGCATGATTAATTCTGTTTTATCTTAGTTATATAGGTAATTTTCCATCAGATAGAATTTTATAGTTCTAGTACAAATACTCCCCACTCAGCCTTTTATGTGCTGAATTTTTGTTCAAACAATGAGATATTGCTCATATTCTTCATACTCTTTTAGAATGTCAGCAGAGGCTAAAGAAAAACACCTTGGCTGTGTCTGTAGAACCTCAACACAGTCAAGAGGATGAAGAAAATTAGACCATAAGTTATATAAACCAGTGCTGTCTCAACTCTTGACTGTCCCCTCTGGCTGCCTCTGAGTCTGAATTTCCCAAAGAACAAATTTCTGGGGAGCACTAGATTGCAGAAGAGTGGGGACAGCATTCATTCAGAGACCTTAAATATTTTATTGATACCATATTCAGCAATGAGCTTTTATATCCATTTTGAGAAATCTCCATAATTTTCAACTTGTAAACTTTTTAAAGACCTTTCTGCATTTTACACATCTGTGATTTGAATAGTGTTATCAATGTTTTTGTAAATATTTAATATGTTTTTCTATTTAGCTAAATTCCAG