Transcript asmbl_14781

Sequence
Transcript Sequence for observation asmbl_14781 of TGE0000317:
CCCAGGTCAAGGCGCGCGTGGGCGGAAGCGGCGGCGGCGGCGAAGGCGGCGGCTGTCAGAGCTGGAGGGCCGGGCACCGCGGCCATGGAGGGTCAACGCTGGCTGCCGCTGGAGGCCAATCCCGAGGTCACCAACCAGTTTCTTAAACAATTAGGTCTACATCCTAACTGGCAATTCGTTGATGTATATGGAATGGATCCTGAACTCCTTAGCATGGTACCAAGACCAGTCTGTGCAGTCTTACTTCTCTTTCCTATTACAGAAAAGTATGAAGTATTCAGAACAGAAGAGGAAGAAAAAATAAAATCTCAGGGACAAGATGTTACATCATCAGTATATTTCATGAAGCAAACAATCAGCAATGCCTGTGGAACAATTGGACTGATTCATGCTATTGCAAACAATAAAGACAAGATGCACTTTGAATCTGGATCAACCTTGAAAAAATTCCTGGAGGAATCTGTGTCAATGAGCCCTGAAGAACGAGCCAGATACCTGGAGAACTATGATGCCATCCGAGTTACTCATGAGACCAGTGCCCATGAAGGTCAGACTGAGGCACCAAGTATAGATGAGAAAGTAGATCTTCATTTTATTGCATTAGTTCATGTAGATGGGCATCTCTATGAATTAGATGGGCGGAAGCCATTTCCAATTAACCATGGTGAAACTAGTGATGAAACTTTATTAGAGGATGCCATAGAAGTTTGCAAGAAGTTTATGGAGCGCGACCCTGATGAACTAAGATTTAATGCGATTGCTCTTTCTGCAGCATAGCTTGTCAATAATGGAAACACCAAAAACTGTATTATTTGCAACTAAATTTTCTCTGCCATACACTAACTCAAAAATTTTGATATTTTCATTA