Transcript asmbl_65789

Sequence
Transcript Sequence for observation asmbl_65789 of TGE0000759:
CTTTGCCTTACCAAAGGGGTCTAGTTCCTATGTTTTTAAGTTTAAAAACTATTCCCGCTATTAGGCTTTCTATTATCTCGAGTCTTTACACGGGATAAGTAAGTTTAAGGGTGGCAAAAGATGAAAGGACCAGAGGGAATACGGGCGAAAGCAGAGCGAGGGTTGGCCTCTCCCCTTCACAAATAATGGGAGGAACCTGGCAAGAGGGAGTTCTTTCCTTTCGCCGCTGCGGTCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCTTGCCTCCAGTGTTCTGCGCTGTGGCAAAAAGAAGGTCTGGTTGGACCCCAATGAGACCAATGAAATTGCCAATGCCAACTCTCGTCAGCAGATTCGGAAGCTGATCAAAGATGGGCTGATCATCCGGAAGCCTGTGACTGTCCATTCCCGAGCACGATGCCGGAAAAACACCTTGGCCCGCAGAAAGGGCAGGCATATGGGCATAGGTAAGCGAAAGGGTACTGCCAATGCTCGAATGCCTGAGAAGGTAACCTGGATGAGGAGGATGAGAATCCTTCGCCGACTGCTCAGAAGATACCGTGAATCTAAGAAGATTGACCGCCACATGTATCACAGCCTGTACCTGAAAGTGAAGGGTAATGTGTTCAAAAACAAGCGGATTCTCATGGAACATATCCACAAGCTGAAGGCAGACAAGGCTCGCAAGAAACTTTTGGCTGACCAAGCTGAGGCCCGTAGATCTAAGACCAAGGAAGCACGCAAGCGCCGTGAAGAGCGGCTCCAGGCCAAGAAGGAGGAGATCATCAAGACTCTGTCCAAGGAAGAAGAGACCAAGAAATAAAGCACCACCTCTCTTACCTGTACATAGTGGCCTTGGCAATTATATAGATCAATCCTTCAATAAAATAGCTTTCATCTGCCTACCTCTCTGTTCTTCCAAAGTTTCTGGCTGTTTGATGAGTCTTCACTATTTAGAGGGCCAGAACTGAGCACACCGAGTTCTGAGATGCAGACCCTCTCCAGAGTGCCAGTTTTCATTCTTTCCTTGGCTCCTGGCCTCTGATAAGGCTCATGACCCCTCTGTCCATGGAAGAGACGGTTTTTTTACCTTGTTTTAGTGGGATGTGGGGCTTACTTTGAAGGGAGGGAAGGAATGACTTCTACTCAACTTCCGAAGTGCTGTGCTTTAAACTGCCTTTTACAGTAGAGCGTGAGTGGCATTTCAGAAGTGGTCTCAGATGTTGGTTGGGAACCAATAGTTGTGACATCAGCTGTCATTGTTTTAAAAACAAAAAACAGAATGCTTACACTTTTCAACTGGGCACTGGGGTCCAAGGTTGAAATCTGCCCTAGAACTCAAGGACAGTGAGAGTTTCAACCACCTCCAGTCAAGCTAATGACACCTGGACTTCACTGACTGCTACCTATGCTTTCTCTAAACAACTTTATTGAAGCTGTCATTTTGAACATTCCAGTTTCTAAACCTTTATGTCCTATCAGGGTTTTGTTTTTTGTTTTCTGTTTTACACTGATAGATTACAAAGAGAAAGGCTTTTCTCAGAAATTGGAATAAAGGCACGCAACAAAAACTGGTCA