Transcript asmbl_65747

Sequence
Transcript Sequence for observation asmbl_65747 of TGE0007322:
AGCCGCCGCCGAGGACTCAGCAGCCTCCCCCTTGAGCCCCCTCGCTTCCCGACGCTCCGTCCCCCCTGCCCGCCTTCTCCCGCCGCCGCCTTCCGCAGGCCGTTTCCACCGAGGAAAAGGAATCGTATCGTATGTCCGCTATCCAGAACCTCCACTCTTTCGACCCCTTTGCTGATGCAAGTAAGGGTGATGATCTGCTTCCTGCTGGCACTGAGGATTATATCCATATAAGAATTCAACAGAGAAACGGCAGGAAGACCCTTACTACTGTCCAAGGGATCGCTGATGATTACGATAAAAAGAAACTAGTGAAGGCGTTTAAGAAGAAATTTGCCTGCAATGGTACTGTAATTGAGCATCCAGAATATGGAGAAGTAATTCAGCTACAGGGTGACCAGCGCAAGAACATATGCCAGTTCCTCGTAGAGATTGGTCTGGCTAAGGACGACCAGCTGAAGGTTCATGGGTTTTAAGTGCTTTTTGGCTCACTGAAGCTTAAGTGAGGATTTCCTTGCAATGAGTAGAATTTCCCTTCTGTCCCTTGTCACAAGTTTAAAAACCTCACAGCTTGTATAATGTAACCATTTGGGGTCTGCTTTTAACTTGGACTAGTGTAACTCCTTCATGCAATAAACTGAAAAGAGCCATGCTGTCTAGTCTTGAAGTCCCTCATTTAAACAGAGGTCAAGCAGTAGGCACCCGGCAGTGTCCAGCCTGAAACAAAGCAATAACGTGATGTTTCGGCCAAGCTCAGAGCCCCAAGATCACAGATGGCTATGTCCAGCCAGAAGCTCCTCGGCTCTCCCTCTACAGAATTCCCTGCCCTAAGAGAATGTCACCACCTGAACAGCCTTCGGTGAAGCTTGAGAGAGGATGGGGTAAGGCAGCAACAGCAGCTGTGCCACTAGAGGGAGCCTCCAGTAGTCAAAGATCCCTTGGTGTCTCCAATCTGACCAGGTGGGTGGAGCTTCAGGCAGTCACCTTCCCGCTGTTGAGGTGATAAGGACACCTGGCTTGCCACCAAGGTGTTTTTGATAAGAAATGTCCTAACCGATGTCCAAACACAGAATGTGAGGCCAACCTTCTATCAGAGTTAAACTTTTGACAAGGGAACAAGTTTCAAACTGATGTGTCATGTAGCTAGCTGTAGAGCTTGCAGTTTACTAGCAAGAGCTGCCCAATGCCATGTGAAGTAACAGATTTTTGGTTTTTTCCCTTCAGTTTTAATGTTATGTAATGTATTTAAACCCTTATTTAAATAAAACTTGTTTTCAGAAA