Transcript asmbl_65664

Sequence
Transcript Sequence for observation asmbl_65664 of TGE0007304:
AGGTTGACTTTTCACCACACTGAAACCATTAGGAAAAATCCTTGTGGTTAACAGCAGAGGCTTCAGAGTGTAACCTGTACTGGGGCCTAGAAATTATTTTAAATGGCGACTGATACGTCTCAAGGTGAACTCGTCCATCCTAAGGCACTCCCACTTATAGTAGGAGCTCAGCTGATCCACGCGGACAAGTTAGGTGAGAAGGTGGAAGAGAGCGCCATGCCGATTCGTCGAGCTGTGAATTCTACCCGGGAAACTCCTCCCAAAAACAAGCTTGCTGAAGGGGAGGAAGGAAAGCCAGAACCAGACGTAAGTTCAGAGGAATCTATCTCTACCGTAGAAGAACAAGAGAATGAAACTCCACCTGCTACATCTAGTGAGGCAGAGCAGCCAAAGGGGGAACCTGAGAATGAAGAGAAGGAAGAAAACAAGTCTTCTGAGGAAACCAAAAAGGATGAGAAAGATCAGTCTAAAGAAAAGGAGAAGAAAGTGAAAAAAACAATACCTTCCTGGGCTACCCTTTCTGCCAGCCAGCTAGCCAGGGCCCAGAAACAAACACCGATGGCTTCCTCCCCACGTCCCAAGATGGATGCAATCCTAACGGAGGCCATTAAGGCGTGCTTCCAGAAGAGTGGTGCATCAGTTGTTGCTATTCGAAAATACATCATCCATAAGTACCCTTCTCTGGAGCTGGAGAGAAGAGGCTACCTCCTTAAACAAGCACTGAAAAGAGAATTAAATAGAGGTGTCATCAAACAGGTAAAAGGAAAAGGTGCTTCTGGGAGTTTTGTGGTGGTCCAGAAATCAAGAAAAACCCCACAGAAATCTAGAAACAGAAAGGACAGGAGCTCTGCAGTGGATCCAGAACCACAAGTAAAATTGGAAGATATCCTCCCATTGGCCTTTACTCGCCTTTGTGAACCTAAAGAAGCTTCCTACAGTCTCATCAGAAAATACGTGTCTCAGTATTACCCTAAACTTAGAGTGGACATCAGGCCTCAGCTGTTGAAGAATGCTCTGCAAAGAGCAGTAGAGAGAGGCCAGTTAGAACAAATAACTGGCAAAGGAGCTTCTGGAACATTCCAGCTGAAGAAATCAGGGGAGAAACCCCTGCTTGGTGGAAGCCTGATGGAATATGCAATCTTGTCTGCCATTGCTGCCATGAATGAGCCGAAGACCTGCTCCACCACTGCTCTGAAGAAGTATGTCCTGGAGAACCACCCAGGGACCAATTCTAACTATCAAATGCATCTGCTAAAAAAAACCTTGCAGAAATGCGAAAAGAATGGGTGGATGGAACAGATCTCTGGTAAAGGATTCAGTGGCACCTTCCAGCTCTGTTTTCCCTATTACCCCAGCCCAGGAGTTCTATTTCCAAAGAAAGAGCCAGATGATTCTAAAGATGAGGATGAAGATGAAGATGACTCATCAGAAGAAGACTCTGAGGATGAAGAGCCTCCACCTAAGAGGTTACAAAAGAAAACCCCAGCCAAGTCATCAGGGAAGGCTGCATCCATGAAGCAGAGAGGGTCCAAGCCTCTACCGAAAGTCCCAGCTGCCCAGCGGGGGAAAGCTAGGCCCCTGCCCAAGAAAGCCTCTCCTAAGGCCAAAACTCCTGCCAAGAAAGCTAGACCCTCACCCTCAGTCATCAAGAAACCTAGTGGTGGCTCTTCAAAGAAGCCTGCGGCCAGTGTGAGAAAGGAAGTGAAATTGCCTGGCAAGGGCAAATCTACCATGAAGAAATCTTTCAAAGCAAAAAAGTAAATTTTATAGGGAAAAAAGGGTATCATGATGAAATTTAAAATCTTATTTTATAAGGTCAGTGTGCATTTGTTTTAGTTTTGATGCTTTTAAAATTATATTTTTTCCTTCCCCTCAGAACATTGTGAGGAGGGAATATAAATAAACCAGTTTAGGCATTCGTTAGCTTTTGGCACTATTCTTGGTGTCTGCCCCTTCCCTCGGTCATTTCATTTTCTGCGATAATTCTGGACTTGCCTGAACTGTATAATCTATACATGTCTATTTTTCTCCCTCCACCCCAACCCTCTTTTTGTTTGTTTGTTTGTTTGT