Transcript asmbl_65553

Sequence
Transcript Sequence for observation asmbl_65553 of TGE0022981:
CGAGCATGTGGGTCTGCTGCGCGCTGCGCTGGTCGCGAACCGCGGCCCGGCTGCGGCCGGGGCTGCTGCTCTCTGCGGGCCGCTGCTCGCCTGCGGCCGCCTCCTACTCTGCTTCTGCCGAGCCCTCCCAGGTCCAGGCGCTGGTCTACGAGCACCACGGGCACCCAACCAAGGCCATCGAATGAGAAAACTGAGGCATCAGAGAGGTGAAATTGCTTCCCCAGAGTCACACAGCCAGTAAGTGGCGGAGTCAGAATTTGAATCCAGAATCCAGATCTGACTGACTGATCTGCCTGAGGTCGTACCTTCTATTATGGGGTGATGTGGAGGAGTGGATTTCAGAATACTTTTGCATCCATTTGGATCTTCCCGTCTCAGTAAAGTAGACTGAAGAACCTGGAGCTAACTGCTGTGGGCGGATCAGATGTCCATGTGAAGATGCTGGCGGCCCCTATCAATCCATCTGACATAAATATGATCCAAGGGAATTATGGCTTCCTTCCCAAGCTACCTGCCATTGGAGGAAACGAAGGCGTTGGACAGGTGGTCGCAGTGGGCAGCAGTGTGACTAGGGTGAAGCCAGGAGACTGGGTGATTCTAGCACATGCCGGTTTGGGAACCTGGCGGACCGAGGCTGTGTTCAGCGAGGAAGCACTGATCAGAGTTCCGAGTGACATCCCTCTTCAAACTGCTGCCACCCTGAGTGTCAATCCCTGCACAGCCTACAGGATGTTGATGGACTTTGAGCAGCTGCAGCCAGGGGATTCTGTCATCCAGAATGCATCCAACAGTGGAGTAGGGCAAGCAGTCATCCAGATCGCCGCAGCCCTGGGCCTGAGGACCATCAATGTGGTCCGAGACAGACCTGACATCCATAGGCTGACTGACAGACTGAAGAATCTAGGGGCTGAGTATGTAATCACAGAAGAAGAGCTAAGAAAACTTGAGCTGAAAAACTTCTTTAAGGATGTGCCCCGGCCCCGGCTTGCTCTCAACTGCGTCGGTGGGAAAAGCTCCACCGAGCTGCTGCAGCGCTTGGCGCCCGGAGGAACCATGGTGACCTACGGGGGCATGGCCAAGCAGCCCGTCATCGCTTCTGTGAGCGTGTTCATTTTTAAAGATGTCAAACTTCGGGGCTTTTGGCTATCCCAGTGGAAGAAGGACCACAGTACAGACCATTTTAAGGAGCTGATCCTTACACTGTGCCACCTCGTCCACCAAGGCAAGCTCACAGCCCCCACCTGCTCCGAGGTCCCACTGCAGGACTACAACCATGCCTTGGAAACCGCAATGCATCCCTTCACATCGTCAAAGCAGATTTTCATCATGTGATAATAATCCCAGAGGAGCCAGAGCAAAGTGCGGGGCAGGG