Transcript asmbl_65417

Sequence
Transcript Sequence for observation asmbl_65417 of TGE0002492:
GCGAGAGTGGCGCCCCCACTGTCCCGGGCCTGGCGCCCCCGTCCTGTCCCAGTCCGCGGGGATACCCCGCTTCTGGGCCCCCGGGAAGCCTGAGAGCGCGGGGCGCGGGTGGGAGGGGGATGCCCGGCTCGCGCGGCGCCGTCAGGGTCATCATCGGATTTGAAATATTTAAAGTGGATAGAAAACTGTTTCAGCAATGCAGACAATTAAGTGCGTTGTCGTAGGCGATGGTGCCGTTGGTAAAACATGTCTCCTGATATCCTATACAACAAACAAATTTCCATCTGAGTATGTACCAACTGTTTTTGACAACTATGCAGTCACAGTTATGATTGGTGGAGAGCCATATACTCTTGGACTTTTTGATACTGCAGGGCAAGAGGATTATGACAGATTACGACCGCTGAGCTACCCACAAACAGATGTATTTCTAGTCTGTTTTTCAGTGGTCTCTCCATCCTCATTTGAAAATGTGAAAGAAAAGTGGGTGCCTGAGATAACTCACCACTGTCCAAAGACTCCTTTCTTGCTTGTTGGGACCCAAATTGATCTCAGAGATGACCCTTCTACTATTGAGAAACTTGCCAAGAACAAACAGAAGCCTATCACTCCAGAGACGGCTGAAAAGTTGGCCCGTGACCTGAAGGCTGTCAAGTATGTGGAGTGTTCTGCACTCACACAGAAAGGCCTAAAGAATGTATTTGACGAAGCAATATTGGCTGCCCTGGAGCCTCCAGAACCGAAGAAGAGCCGCAGGTGTGTGCTGCTATGAACGTCTCTCCAGAGCCCTTTCTGCACAGCTCATGTCGGCATCATACTAAAAGCAATGTTTAAATCAAACTAAAGATTAAAAATTAAAATTCGTTTTTGCAATAATGACAAATGCCCTGCACCTACCCACATGCACTCATGTGAGACAAGGCCCATAGGTATGGCCCCTTTCCCCGTCTCAATACTAGTTAATTTTGAGTAATTGTGTATTGTCAGAAAAGTGATAAGTACTAGTTCTTGTTTTGTTGTTTCAAAAAAATTTTTTTGTTGTTTTTTTTGTTTAAAAGCAAGGCATGCTTGTGATGACTCTGTAACAGACTAATTTGGGTTGTTGAGCTGCTCCCGGGTTCCACTCCGGAGAGTGATCTGAGACATTTA