Transcript asmbl_65416

Sequence
Transcript Sequence for observation asmbl_65416 of TGE0002492:
GAGGAGACCCCGCGCAGTGCTGCCAACGCCCCGGCGGAGAAGCTGAGGTCATCATCGGATTTGAAATATTTAAAGTGGATAGAAAACTGTTTCAGCAATGCAGACAATTAAGTGCGTTGTCGTAGGCGATGGTGCCGTTGGTAAAACATGTCTCCTGATATCCTATACAACAAACAAATTTCCATCTGAGTATGTACCAACTGTTTTTGACAACTATGCAGTCACAGTTATGATTGGTGGAGAGCCATATACTCTTGGACTTTTTGATACTGCAGGGCAAGAGGATTATGACAGATTACGACCGCTGAGCTACCCACAAACAGATGTATTTCTAGTCTGTTTTTCAGTGGTCTCTCCATCCTCATTTGAAAATGTGAAAGAAAAGTGGGTGCCTGAGATAACTCACCACTGTCCAAAGACTCCTTTCTTGCTTGTTGGGACCCAAATTGATCTCAGAGATGACCCTTCTACTATTGAGAAACTTGCCAAGAACAAACAGAAGCCTATCACTCCAGAGACGGCTGAAAAGTTGGCCCGTGACCTGAAGGCTGTCAAGTATGTGGAGTGTTCTGCACTCACACAGAAAGGCCTAAAGAATGTATTTGACGAAGCAATATTGGCTGCCCTGGAGCCTCCAGAACCGAAGAAGAGCCGCAGGTGTGTGCTGCTATGAACGTCTCTCCAGAGCCCTTTCTGCACAGCTCATGTCGGCATCATACTAAAAGCAATGTTTAAATCAAACTAAAGATTAAAAATTAAAATTCGTTTTTGCAATAATGACAAATGCCCTGCACCTACCCACATGCACTCATGTGAGACAAGGCCCATAGGTATGGCCCCTTTCCCCGTCTCAATACTAGTTAATTTTGAGTAATTGTGTATTGTCAGAAAAGTGATAAGTACTAGTTCTTGTTTTGTTGTTTCAAAAAAATTTTTTTGTTGTTTTTTTTGTTTAAAAGCAAGGCATGCTTGTGATGACTCTGTAACAGACTAATTTGGGTTGTTGAGCTGCTCCCGGGTTCCACTCCGGAGAGTGATCTGAGACATTTA