Transcript asmbl_64377

Sequence
Transcript Sequence for observation asmbl_64377 of TGE0007215:
GAAGGGTCGGGCCCGCGATTAGGTCATGGCGCTGGCCGCTCGACTCTGGCGCTTTCTCCCTTCGGGACGCGGCACTGCCGTGGGAACTCGGTTTCTGACGGGTGCTGCTGGCAGCCGCGGGACTTGCGGGCCTGGGCGACTCGGCGGCTCTGAGGTGATGGGAAACCCAGGAGCCTTTAAAAGAAGCCTCATATTCTCAGCCTTGTCTTATTTGGGTTTTGAGACTTATCAAGTCATCTCTCGGACTGCTGTGGTTCATGCCACAGCCAAAGTCTTGGGAGTTGAAGAAGTCCTTGCACAAGCAGACTACCTCTACGAAAGTGGAGAAACAGAAAAACTTTATCAGCTGCTGACCCAGTACAAGGACAGCGAAGATGCAGAGTTACTGTGGCGTTTGGCACGGGTGTCACGGGACGTAGCTCAGCTTAGCAGAACCTCGGAAGCGGAGAGAAAGCTGCTGGTGTACGAAGCCTTAGAGTACGCAAAAAGAGCTCTAGAAAAAAACGAAGCAAGCTTTGCAGCTCATAAGTGGTATGCCATCTGTATTAGCGACGTTGGAGATTACGAAGGCATCAAGGCTAAGATTGCAAACGCCTACGTTATCAAGGAGCATTTTGAGAAAGCAATCGAACTGAACCCTAAAGATGCTACTTCAATTCACCTAATGGGCATTTGGTGTTACACGTTTGCGGAAATGCCTTGGTATCAGAGGAGAATTGCTAGAATGCTGTTTGCAGCCCCGCCCAGCTCCACCTACGAGGAGGCCTTGGGCTACTTCCAAAGAGCAGAGCAAGTGGATCCGAACTTCTACAGCAAAAACTTGCTTCTCCTGGGAAAGACGTACTTGAAGCTGCACAACAGAAAGCTCGCTGCGTTCTGGCTGGTGAAAGCCAGGGACTACCCCGCACACACCGAGGAGGACAGGCAGATTCAGATGGAAGCCGCTCAGTTGCTTACAAGTTTCAGTGACAAGAATTGAGAATTTTTCAGAGAAGAAAACACATGAAATACCTAGGAACCACCACCTTTTCATCAAATTACAAGTACATTATAACTGTTCTCTGT