Transcript asmbl_64297

Sequence
Transcript Sequence for observation asmbl_64297 of TGE0007199:
GCCGGCTTGGTTTGTGAGGAAGGGCCTAGGCCCAGGCCTGCTGTGCTGGGCTCGCTGAGCGCCGGAGCTCGCGTCCTGCTGTCACCTCTACCCCAGCTTCGCCCACAGCCCGTCCCAAACGGGCTGGGCGCAGGGGAGACCTGCCGGAGCCATGGAGGACGAGGTGGTCCGCATTGCCAAGAAGATGGACAAGATGGTGCAGAAGAAGAACGCGGCTGGAGCACTGGATTTGCTGAAGGAGCTTAAGAATATTCCCATGACCCTGGAATTATTACAGTCTACGAGAATCGGAATGTCAGTGAATGCCATTCGCAAGCAGAGTACAGATGAAGAAGTTACATCTTTAGCAAAGTCTCTCATCAAATCCTGGAAAAAGTTATTAGATGGACCATCAACTGATAAAGATCCTGAAGAAAAGAAAAAAGATACTGCAATTACATCACAGAATAGCCCAGAGGCAAGAGAAGAAAGTAGCTCCAGTGGCAATGTAAGCAGCAGAAAGGATGAGACAAATGCTCGAGATACTTACGTGTCATCTTTCCCTCGGGCACCAAGCACATCTGATTCTGTACGGTTAAAGTGTAGGGAGATGCTTGCTGCAGCTCTTCGAACAGGAGATGACTATATCGCTATCGGAGCTGATGAGGAAGAATTAGGATCTCAAATTGAGGAAGCTATATATCAAGAAATAAGGAATACAGACATGAAATACAAAAACAGAGTACGAAGTAGAATATCAAATCTTAAGGATGCAAAGAATCCAAATTTAAGGAAGAATGTACTGTGTGGGAATATTTCTCCTGACTTATTTGCTAGAATGACTGCAGAGGAAATGGCTAGTGATGAGCTCAAAGAGATGCGGAAAAACTTGACCAAAGAAGCCATCAGAGAGCATCAGATGGCCAAGACAGGTGGAACCCAGACTGACTTATTCACATGTGGCAAATGTAAAAAGAAGAATTGTACTTATACACAGGTACAGACCCGTAGTGCTGATGAACCGATGACAACATTCGTTGTCTGTAATGAATGTGGAAATCGATGGAAGTTCTGTTGAATTGGAAGAATTGGCAAAATGTCTGGACCATTAAGAAAATGGATTTTGTAATTAGCTTTAAAACTAGGCCAAGGAACTAGGTTTTCTGCAAGTCAGGTTTTTAAAGTGACATACACCCCTTGGTTAGTCTTTGTTTTTGACATAGCATCCTTCCTTAAATGCCTTCTGTAGTTTCAGATCAGTAGGGAGACTACATAATAATTGTATGGTATCCGTTTCAAACATTTCTTTTTCATTTTTATAGGTAATCGATATTAAACTTTTATCAATTAAACTTTTGGCAATTTATTTTTACCTTTTTTCCTTCTTAAAGGGAAATGTACCTTAACTTTTTTACAGTCTGAAACATACACAGTAGAAATGTTATTTTCACTTAACACATAAATGAAAATTACATTTTTTTTCCATATTGGCATGTACCTGCAAATGTTAACAGAGAAGAGAGGTAATATAATTTTAAGTTTATCAACTGTGGTGTGTATTCAAATAATACTTGAGCAGCTCAACTAAATTGTACATAATATTTGAAGTAGCATATGAAATTGGTTTTAATTATTATATTCACAAGTCTGGGATAATTAGATATTTTTTTTTATTTGTAACTAACCGTGACCATCATTTCTTGTAATTTCTTGTACATGTTATTACTTGTTCCTAATAGATTTTACTTTTGGAAACATGACTTGACTTTGTTGAAATCAGTTTGGGTTTGTTGTCTGTTTACCTGTTTGACTTCATAGTGGATTTTAGTTTTGCAGAACACTGTTTAGGTTAGTAGGCTTTTCATAAATCCCAGCACAGGCAGAGAATGAAAGCTCCTGGCAATTTTCTTCCCCTCATAAGAAGACATACTGGGAAGAAAACATTAGCATTTTAGTATAGTGTAATTATAAGTAGTTCATGACTTGATTTTGATTTGGAAATCTATACTGACCAAGGATCAAGTTTAAGGATTATATAAATTCTTTCCATATGGAGGTCGATAGAAAATATTTTTGTCCTAAGTCTAATTGGCTGACTTTTTCTGTTACACAGTGAATGAGGTTGTTGAACAAACTGAATATATGGCCTATAATGCAATTTGTTTTATAGTACAGATCTTACAATTAAGTTTTACTTTTTGTTTAAGTGTGTATCATTTGTTTTGTTAGGATAAGAAAAAAATGACTTTCACTTAGGTTCCTGAGGGCACACTTGCTCTAGTACATCTTAAAGGCCACTGTTACAAAGTTCACATTTTATCATGTTACATCTGTATTCTGTCAGATACCTACAGAAGGACCTAAGTACATGCTTTGCAGTCCCCTTTGTTCCCATATTCTCATTTGTTATTGGAAATAACTTGACGTAATACAGAGACGACATTTAAAGGTCCATGTTAAGACCCCACCTATAAGAATTGGCCCACTGGTATCATTCCACTTCTGCTTTGTCAGTTCACAGATTAATATTTTGTTTTATCATTTGAAAAATAAAGTACATTTTTGAAAGAATGAATTTTAAGAAGAATAAAATTAAAATTGTCCCACTTTTAAATTTAGTGATCCATTTTAAAATTTGTAATTCAATAAAGTTTCTTGTTATTAAATTGTA