Transcript asmbl_6407

Sequence
Transcript Sequence for observation asmbl_6407 of TGE0007136:
GGAAGCCCGCGGTGTCCGGTCCCAGCCTTCTCTGGGAGCGGGCGGTGGGCAACGCCGGGGTGACCCGCGCCCCTCGTTCTTGAGCCCGCGCGCTCTGAGAGGGTGCTCGGACAGATTGAAGCCATGGCTATTCTTTTTGCCGTCGTTGCCAGGGGAACCACCATCCTTGCCAAACACGCTTGGTGTGGAGGAAACTTCCTGGAGGTGACAGAGCAGATTCTGGCTAAGATACCTTCTGAAAATAACAAACTAACGTACTCACACAGCAACTATTTGTTTCATTACATCTGCCAAGACAGGATCGTGTACCTTTGTATCACTGATGATGATTTTGAACGTTCCAGAGCCTTTAATTTTCTGAATGAGATCAAGAAGAGATTCCAGACCACGTATGGTTCAAGGGCACAGACAGCACTCCCATATGCCATGAACAGTGAGTTCTCAAGTGTCTTGGCCGCACAGCTGAAGCATCATTCTGAGAATAAGGGCCTAGACAAAGTGATGGAGACTCAAGCCCAAGTGGATGAACTGAAAGGAATCATGGTCAGAAACATAGATCTGGTAGCTCAACGAGGAGAAAGATTGGAATTATTGATAGATAAAACAGAAAATCTCGTGGATTCGTCTGTCACCTTCAAAACAACCAGCAGAAACCTTGCCCGAGCCATGTGCATGAAGAATCTCAAGCTCACCATCATCATCATCGTCGTATCAATCGTGTTCATCTACATCATCGTGTCACCTCTGTGTGGTGGATTTACATGGCCCCGCTGTGTGTAAAAATAGAAAAGACAAAGTTATTCACCGGACGACACGAGAGAACAAGGAGTTAAAAGGCCGAATGATCTAAACCTTTCACTACTGACAGATGGCGTCTGCCAGTCTCTTCAGCCCTCTCTTTCTCTTTCTGTTTTTAATCCTGTTCTATGCATCCAGATTTATCTTTGTCCTCTCAGTCAGTTTATTCCAGTGTACTTCAAAATGAACCATTTATTGCAGCAGTAGCCTTAAAAAGGCTTTTGTCCGTTCCTTTGGTTTGTTCACTAGTATTATAGACTCAGAGAAACGTTTTCGTCGGTGATTGCACAAAGCCATCGCCAAGGTGGAAAACACCAGTCTTGTAAACTGCCTGCTAAAACTGTAGCTGAACATTGTACGTGCACAGAAAAGTATTCGAGAGACACGTATTGCTACCATCTCATGTTTATGTCTTTTGGTATTGAGGAGTTTTAGATGCTCGAAAACAATACGAATGGAGAATTACTGTTATTTGGGGAATTGTAATTCAATTGTTGGTGCTGCCTGCTTCTAGCAGCCCAAGCAGATAAAGTATTAGACATTCTGTCTTGGTCAGAGGGAGAATATTTTTAGAAGCACGTGGAATTATGTTCGACTTCCTAGTACTCACTTTCAGGAAGAAAGATTTGACCATTTGCAAACCTCACAGAGCTCAGTAGCTTCTGTTTCCCCGTTGCAGTTGATTTGAGAAGATAATGGTTTAAATATGGCCGAAGGTTATGGTTTTCCACATATTTCTTTGGTCCTCAGTTGATTTTTAGAGCCATTCTATAGTTAATAGAATAGACAGTGGAGGGGGTGGGGAGGCACCACAGAGGACACGCTAACGTTTTAGCTCTGTGAATGGAGGCAGCGTGGGAAGGTTTTTCCTTTCTGGGAAAAGCCCAAACAGAACATGGTCAGCTCCAGGGTTTGGGTCTGGCTGCTGTCGAATAATAATAGTCTGAGCATCCTTTGTGGTTCAGTAAGTTCTTTAATCTGCCTACTTTTGAAGAATTCTTTCGTGAAACGAGAGTAGGCACGACGATGTCTAGAAACAACGCAAGACAGTTCAGCATCCATTTAACTGCACTGTAGGAAAACTGCTGTGGATGCTTCGCTTCGGCGACTGTGACGTCTCTCTGCTGGTGTGTACTTTTGGTGTGTATCTGGAAGGACATTTACTGCTCTGGATCTAACTGCATTTATTGATCAATAAATGCCAGTAAGCAGAAATTCTATTATATTCGACTATTTTCCCAATAAAAGAACAAATCAGTCTGTAAAACCTAGCCACCTGTTTAGCCTAGTCACGTGCCTTGAATATATATGTGTCATATAACCTGGCTGATGCTACCTGTTCTTCCACGTAAACCTTTCGGTTCATTAATTGGACACGGATTTCAGGCCCACTGGAACGCTTTTCCTGGCGACCATGCATTCTACAAATGTTCTCTTTATCAACACTAATGCCTTTTAATTGCATCAGCATTTCCTACTGGAAAACACATTTGTTCCAGGAAAACATTTGCCATTCCTGAATAATAATTTCCAAATGTCTTTAATCCAAAGAAGAGGACTTAAAGTGGATTTCCCTTTCGTATACACGACTGAATAAAAATGATGTGCATGTCTTAGGGATAAATGACTTAACTGTCCCTCGATCTGTTTATGTATAAGAATGCTTTTTAAAGCACATATCTTGTTTTAAATGACGCACAAACTGAAGGCATTAATAAAATTTAAGAGTAATACAA