Transcript asmbl_63950

Sequence
Transcript Sequence for observation asmbl_63950 of TGE0007193:
AGCTCAAGAGATGGCTGCCCAGTGTGTGACAAAGGTGGAGCTGAATATTTCCTGCGACAATCTTCTGGATAAAGACATAGGGTCCAAGTCGGACCCGTTATGCGTGTTATTTTTGAATACGAGCGGCCAGCAGTGGTATGAGGTTGAGCGCACAGAAAAGGTCAAGAATTGCTTGAATCCCACATTTTCCAAGACTTTCATTATTGATTACTACTTCGAAGTGGTTCAGAAATTGAAATTTGGGATTTATGACATCGACAACAAGACTATAGAGCTGGGCGATGATGACTTCTTAGGAGAATGTGAATGCACCCTTGGACAAATTGTTTCCAGTAAGAAGCTGACCCGACCCCTGGTGCTTAAGAATGGCAGACCTGCGGGGAAAGGCAGCATCACGATTTCGGCTGAAGAGATAAAGGATAACAGAGTCGTCTTGTTTGAAATGGAAGCCAGGAAACTGGATAATAAGGATCTCTTTGGGAAGTCAGATCCGTACCTGGAATTCCACAAGCAGACATCTGATGGCAACTGGCTCATGGTTCACCGGACAGAGGTTATTAAAAACAACTTGAATCCTGTTTGGAGGCCTTTTAAAATCTCCCTTAACTCCCTGTGCTATGGAGATATGGATAAGATTATCAAGGTAGAGTGCTATGACTACGATAACGATGGGTCACATGATCTCATTGGAACATTCCAAACCACCATGACGAAACTGAAAGAGGCCTCCAGGAGCTCGCCTGTTGAATTTGAATGCATAAATGAAAAGAAGAGACAGAAGAAGAAAAGCTACAAGAATTCCGGTGTCATCAGTGTGAAGCAGTGTGAGATTACAGTGGAATGCACATTCCTTGACTATATCATGGGAGGCTGTCAGCTGAATTTTACTGTGGGGGTGGACTTCACTGGCTCCAACGGTGACCCACGGTCTCCTGACTCCCTTCATTACATCAGCCCCAACGGCGTGAATGAGTACTTGACCGCCATCTGGTCTGTGGGGCTGGTCATTCAGGATTACGATGCTGATAAGATGTTTCCAGCCTTTGGGTTCGGAGCTCAGATTCCTCCTCAGTGGCAGGTGTCGCACGAATTCCCCATGAGCTTTAACCCGTCCAACCCCTACTGTAATGGAATCCAAGGCATTGTGGAGGCATATCGGGCCTGTCTTCCTCAGATAAAACTCTATGGACCAACAAATTTTTCTCCCATCATCAATCACGTGGCCAGGTTTGCTGCCGCAGCCACACAGCAGCAGACAGCTTCTCAATACTTCGTGCTGCTCATCATCACCGACGGTGTGATCACGGACCTGGACGAGACCAGACAGGCGATCGTCAGCGCCGCCAAGCTGCCCATGTCCATCATCATCGTTGGCGTCGGCGGCGCTGACTTCAGCGCCATGGAGTTTCTGGACGGTGACGGTGGGGGCCTGCGCTCCCCGTCAGGGGAGACTGCCATCAGGGACATCGTGCAGTTCGTGCCTTTCAGGCAGTTCCAGAATGCTCCCCGAGAAGCGCTGGCTCAGTGCGTCCTGGCGGAGGTCCCCCAGCAGGTGGTGGGCTACTTCAATACCTGCAAGCTCCTGCCCCCCAAGAACCGCACCGCCCAGTGAAAACGCTCCTGCGCCGCACTGCGGGCTGCCCGTTTCCCACGCTCCCCAGCATCCGTGACGGAAACCGAGTCCCCGTGGACTGCGTCTCCTTAAAGCATTCTTTTATACTTTTCTTGGAAGAAAGTGCTAACTTAACCTTTGTCCAATCAATTCAGTGATTGCTAGTGATTAGAGACTCGCACGAGGAAAGCCGCCTTTGCCATGGTGATTGTTTGCTCTCACAGGATGAAGATGCTGGTTGGAACATTCGTCAGTAGAGAGGATGAAGACTTGTTGGGGGTGGGGGAATTTCAGGCCGCTGTGCTTCGTCGGCTCGAGGCCACATGTGCTACAAGTCAGTGTCCGTCCCCGGTGACGGGCGCTTCTCAAAGCAGACGTGCTGAACCTGTCCCTGCAGTTGCTGAGTGCCTGACCCTTGCCCAAGTCTCGCTGCGGCTTAGCCACAGCACAGCTCGCCCCAGCAGCACCCCAAGACTCTCCGAAGAGCGCAGACGAGGACAGGCACCCTTGCACTTCTCAAAAGGAAGAGGAGCCTCAGGAACGTGCGCGGCTGTTCCCGTGTGCCTTTCCAGGACCCGTGTCTGCACGGAGGGCAGGCCGACCGGGCTCAGCGTCAGTAGCGTTTTTTAATTGGAGTTTGTCAGAATGGTTACGACTGCCTAGTCCAGGAAAGCTACGAGGACCAGACGTGTAGAGAAAACTGAGAATCCCTTCCCTTTTAGCCAATGAAGACTTTACTTACTAAGAAAGGACAATTTTTATCCTTGCTGAGGTCCTATACATTGATTAGTACATTTCTTCACATTCGTGTAGACATTTTTTCCTGTTTTCTTTAGTTACTCTTTTAGTCTGGTTTTTAAACTCATGATAGTGGTTGTCTATTAATCAAAATCATATTTTGCATTTTAATAATGTGCTATTTCCTAAGCCCAGAATGTACTGTATTAAGCCTAAAACCTGTTGCAACTTAAAAAAAATAGCCAACATGCTCTAAGAGCAGAATTCCCCCTTTCAGAATACATTACTCAGCAAACGCTGTCAGAACAGTCAGTAATGTTTTATTGAGGACCTGTGTGCCAGGTACCACGCATACCCACATGTTGGCCAATTATCTTGGATAATTTGACATGAAAATTTGCATGTTTGTCATGTACCCTCAAGGGGACACGCCCAGTGCCATGCCAGCATGCCTTTCGCTCTTTCTGAAACTGCGCCACGGCTCTGGTCTCTTGTTCTCTGAGATGTCTGAAGGACGCGTGAGCCTCGGCCAGGCTCCGTCTGAGAGGGGAGCTGCCTGCTGTCGTGGTCACCCAGCCAGGCGGGCAGTCACCGCCTTCCCGCTCAGTCCGCTGGTCCCTGGCTGCGCGCTGCTGACCTGAAGGCGCCTGACTGGCCGTCTGTACTCCAGGGAGCGGCTCCTTGGCCGGCAAGCCCTTCTGCTGTCAGTTAGGGGAGGGGACTGACGTCCCGCCCAAAGGCTGGGGCCTGCGCTGTCTCAAGTCCTGGTTTGGGTCCTGCGCCTGGGAACAGCACGTGCGTGCCGCTGTTTCAGAAGTTCCTTCTGCAAACACGCGAAGCCTTCTAGAAAAGGTTCCCACACGTTCCCCACGCCTGGTGAGACGCTCAGGAGCAGAGCCCTCGGTTGGGGTCGGCCGGGCTGCACGCCACTCCCCGGGCCTCCTCGTCACCCCCTCACCGCTCCTCATGCTCCTCACAGCTGTGGCCTCTGCAGGGCACTGGGGACCGCTGTCGTGGGTGCTCACTGAGGTCACTGGCCAAGCACGGTACTCTGTCACCACCATCAAATTGATTTGGTCTTCATAGTTACATCATCTGTTTTAACCAAAATTGTTCCCTTTTAAAATTAGTTTTTTGTTATTCATTCTTGATCGGGTTCATCAGTAGATGCTGTTATTCATAAGAACTGTGATTCCAGCAAATTAAGGTAATTGATACCTTTTTGCAGTTTTGAATAAACGCATTTACAATTTCTAAATAATATAAAATTCATACGATTTCGACGTTTCACCTCATTGCCTGCTGATTTAATATTGTTTTATATTAAAAGTCATTTTCCCTGTTGTGCCACCGTTCATTCAAGTGCCATTAGTTCTTAAAATGCCTTTACAGAAAACACAAGCAGTTTGCCTTCCACACCTCCCAGCATGAGACACACTGCGAACGCGTTTGGCCTGACAGCGCCCCGGGCAGAGGCACGGCTTCTCCCCTGCCCGCTGCTAGACGGTGCGCCAGCTAGCACGGCCGCGCCATCGAGCGCTTGGGACCGAAATGGTTACGGTCCCAGGTTTAGTCTCAGGGTGACACTTGTGCCCTGTGCCGTTTCTCCGCAGACTTCCCAGAGCAGATTCAGGGCCCAGTGCTGCTGACGCTTCATTCCACGCGCTGTGCCCTTTTCATTTTGTAAACTTCCCGGAAAGCCACCTTCAGTAGACGCCTCCTAATCTACGTGTGCCATCGACGGTCATGGAAGTGACACATAAGCGAGAAGTTTGGCGTTAATTGCGAGAAACTATTTTGTGCTTTTTGGATGTCATACTCGACAGTGTACAAGTTACAAATACATGAATTGATGTTGAATATATCTCCCATTTGAGATCCCTTTGGATAAAGTTATTTCTTGATGTGACACACAAGAGTGCCTTGTTCTCATTTTTTT