Transcript asmbl_62460

Sequence
Transcript Sequence for observation asmbl_62460 of TGE0007064:
CACCCGCCCCCCAGACTCGGAGATCTCAGAGGCGCCAGCTGGGAGGACCTATTAGAGCGATTGCCCAGACGCCGGTGACTCAGTGTTCGCGGGAGCGCCGCAGCCACACCAGCCAACCCGGATCCTAGGTCTGACAGCGCCGGCCCGGGTCCCCGCCTGCCAGGAGTAAGCCGACAGGCGGCCGGCCCCGCGTGTCCGACCCAGAGCCACCTCTGTCCTTCGACCCGAGCTCCGCGCCCTTCCTGCGATCCCTGCCCCGCGGGCAGCGCTGCCATCCTGCCGGCCATGGAGACTCCGTCCCAGCGGCGCGCCACCCGCAGCGGGGCGCAGACCAGCTCCACCCCGCTGTCGCCGACCCGCATCACCCGGCTGCAGGAGAAGGAGGACCTGCAGGAGCTCAACGACCGCTTGGCGGTCTACATCGACCGTGTGCGCTCTCTGGAGACGGAGAACGCGGGTCTGCGCCTTCGCATCACCGAGTCCGAGGAGGTGGTCAGCCGCGAGGTGTCCGGCATCAAGGCCGCCTACGAGGCCGAGCTCAGCGATGCCCGCAAGACCCTCGACTCGGTGGCCAAGGAGCGCGCCCGCCTGCAGCTGGAGCTGAGCAAAGTGCGCGAGGAGTTTAAGGAGCTCAAAGCGCGCAATACCAAGAAGGAGGGTGACCTGATGGCCGCCCAGGCCCGGCTCAAGGACCTGGAGGCTCTGCTCAACTCTAAGGAGGCCGCACTGAGCACGGCCCTCAGCGAGAAGCGCACGCTGGAGGGCGAGCTGCATGACCTGCGGGGCCAAGTGGCCAAGCTCGAGGCAGCCCTGGGGGAGGCCAAGAAGCAGCTTCAGGACGAAATGCTGCGGCGGGTCGATGCCGAGAACAGGCTGCAGACCCTGAAGGAGGAGCTAGACTTCCAGAAGAACATCTACAGCGAGGAGCTGCGTGAGACCAAGCGCCGCCACGAGACCCGGCTGGTGGAGATTGACAACGGCAAGCAGCGGGAGTTTGAGAGCCGGCTGGCCGACGCCCTGCAGGAGCTGCGGGCCCAGCACGAGGACCAGGTGGATCAGTACAAGAAGGAGCTGGAGAAGACCTACTCTGCCAAGCTGGACAACGCCAGGCAGTCGGCCGAGAGGAACAGCAACCTGGTGGGGGCCGCCCACGAGGAGCTGCAGCAGTCCCGCATCCGCATAGACAGCCTGTCCGCCCAGCTCAGCCAGCTGCAGAAGCAGCTGGCAGCCAAGGAGGCGAAGCTGCGGGACCTGGAGGACTCGCTGGCCCGCGAGCGTGACACCAGCCGGCGGCTGCTGGCGGAGAAGGAGCGGGAGATGGCGGAGATGCGGGCGCGGATGCAGCAGCAGCTGGACGAGTACCAGGAGCTGCTGGACATCAAGCTGGCGCTGGACATGGAGATCCACGCCTACCGCAAGCTGCTGGAGGGCGAGGAGGAGAGGCTCCGCCTGTCCCCCAGCCCCACCTCGCAGCGCAGCCGAGGCCGTGCCTCCTCCCACTCGTCCCAGACGCAGAGTGGGGGCAGCGCCACCAAGAAGCGGAAGCTGGAGGCCGCCGAGAGCCGTAGCAGCTTCTCCCAGCACGCGCGCACCAGCGGGCGCGTGGCGGTGGAGGAGGTGGACGAGGACGGCAAGTTCGTGCGGCTGCGCAACAAATCCAGCGAGGACCAGACCATGGGCAACTGGCAGATCAAGCGCCAGAACGGAGATGACCCCTTGCTGACCTACCGCTTCCCACCGAAGTTCACCCTGAAGGCCGGGCAGGTGGTGACGATCTGGGCTGCAGGAGCTGGGGCCACCCACAGCCCCCCGACCGACCTGGTGTGGAAGGCACAGAACACCTGGGGCTGTGGCAACAGCCTGCGCACGGCCCTCATCAACTCCACCGGGGAGGAGGTGGCCATGCGCAAGCTGGTGCGCTCGGTGACTGTGGTCGAGGATGACGAAGACGAGGATGGAGATGACATGATCCATCACCACCACGTGAGTGGCAGCCGCCGCTGAGGCCACGCCCACACCCACACCCACACCGGGCGCCAGCCAGGCCCGGCCGCCTCGCCCAGCCTCCCCACACAAAATCTTGTCATTAAAGAGTGTTTTGGAACTTGACTTGCTGCCCTGGCTCTTCTTCTCTCTCCTCCCCATACCTTGAACAGGGACCCCAGGTGTCTGGGCGCCCTACTCTGGGCTCCCACTCGACCCCGCCGAGTACAACCTGCGCTCCCGCACCGTGCTGTGCGGGACCTGCGGGCAGCCTGCCGAAAAGGCGTCCGCAAGCGGCGCGGGAGCCCAGGTGGGCGGATCCGTCTCCTCTGCCTCCTCCGCGTCCAGCGTCACGGTCACTCGCAGCTACCGCAGTGTGGGGGGCAGTGGGGGTGGCAGCTTCGGGGACAACCTGGTCACCCGCTCCTACCTCCTGGGCAACTCCAGACCCCGAACCCAGAGCCCCCAGAACTGCAGCATCATGTAGTCCGGGACCTGCCGGGCCGGGGTGGGCCGGAGGCCTCCTGCTTCCTCCGCGGTCATGCCCACCGCCTCCCTGCACCTCGCGGGAGGGGCTTCAAGCCAAAGAAAATACCCCTTTGTTTTTTCTTCTATGTTTTGTTTTTTTTTCTAAGAGAAGTTATTTTCTACAGTGGTTTTATACTGAAGG