Transcript asmbl_61343

Sequence
Transcript Sequence for observation asmbl_61343 of TGE0007022:
GTTTGTTCTTGGTCTGCAGCCGCTGCTGCCACCTCTTACCAGCGCCGTTGCTGCGGGGGATTGTGGGATCCTTCGCGTCCTGTTCGCTAGGAGAGAGGTACCTCTCCTTTTCCCTTTCCCTTTCCTTAAGAGTTGTCTGCTGGTTCTCAGCTTGAAGAAGATTCTACAGTCCTTATTGATCCTTTTTCTTGGCGTTACCATTTTTTTGAAGCAAAGTTGACCTAGTTTTGTAGTTTGAGCTTTCTTTTTGGCCATCTTTTAAGAAAATTTTTTTGGTAATCTATAAATTAGCCAAGAGATAGTTCTACAATGTCCAAGTCATTCCAGCAGTCATCTCTCGGTAGGGACTCGCAGGGTCATGGGCGTGACCTGTCTTATAGGCCTTCTTGCTGCTGCTACCCAGTCTTTAAGTATGCCAGCATCTCTTGGAAGGATGAACCAGGGTACTGCACGCCTTGCTAGTTTAATGAATCTTGGAATGAGTTCTTCATTGAATCAACAAGGAGCTCATAGTGCACTGTCTTCTGCTAGTACTTCTTCCCATAATTTGCAGTCTATATTTAACATTGGAAGTAGAGGTCCACTCCCTTTGTCTTCTCAACACCGTGGAGATGCAGACCAGGCCAGTAACATTTTGGCCAGCTTTGGTCTGTCTGCTAGAGACTTAGATGAACTGAGTCGTTATCCAGAGGACAAGATTACTCCTGAGAATTTGCCCCAAATCCTTCTACAGCTTAAAAGGAGGAGAACTGAAGAAGGCCCTACATTGAGTTATGGTAGAGATGGCAGATCTGCTACACGGGAGCCACCATACAGAGTACCTAGGGATGATTGGGAAGAAAAAAGGCACTTTAGAAGAGATAGTTTTGATGATCGTGGTCCTAGTCTCAACCCAGTGCTTGATTATGACCATGGAAGTCGTTCTCAAGAATCTGGTTATTATGACAGAATGGATTATGAAGATGACAGATTAAGAGATGGAGAAAGGTGTAGGGATGATTCTTTTTTTGGTGAGACCTCGCATAACTATCATAAATTTGACAGTGAGTATGAGAGAATGGGACGTGGTCCTGGCCCCTTACAAGAGAGATCTCTCTTTGAGAAAAAGAGGGGCGCTCCTCCAAGTAGCAATATTGAAGACTTCCATGGACTCTTACCGAAGGGTTATCCCCATCTGTGCTCTATATGTGATTTGCCAGTTCATTCTAATAAGGAGTGGAGTCAACATATCAATGGAGCAAGTCACAGTCGTCGATGCCAGCTTCTTCTTGAAATCTACCCAGAATGGAATCCTGACAATGATACAGGACACACAATGGGTGATCCGTTCATGTTGCAGCAGTCTACAAACCCAGCACCAGGAATTCTGGGACCTCCACCTCCCTCGTTTCATCTTGGGGGACCAGCAGTTGGACCAAGAGGAAATCTAGGTGCTGGAAATGGGAACCTGCAAGGACCAAGACACATGCAGAAAGGCAGAGTGGAAACTAGCCGAGTTGTTCACATCATGGATTTTCAGCGAGGGAAAAACTTAAGATATCAATTATTACAGCTGGTGGAACCATTTGGAGTAATTTCCAATCATCTGATTTTAAATAAAATCAATGAGGCATTTATTGAAATGGCAACCACAGAGGATGCTCAGGCTGCAGTGGATTACTATACAACCACACCAGCATTAGTATTTGGCAAGCCAGTGAGAGTTCATTTATCCCAGAAGTATAAAAGAATAAAGAAACCTGAAGGGAAGCCAGATCAGAAGTTTGATCAAAAGCAAGAGCTTGGACGAGTGATACATCTCAGCAATTTACCTCATTCTGGATATTCTGACAGTGCTGTCCTTAAGCTTGCTGAGCCTTATGGGAAAATAAAGAATTATATACTGATGAGGATGAAAAGTCAGGCATTTATAGAGATGGAGACCAGAGAAGATGCAATGGCAATGGTTGACCACTGTTTGAAAAAGGCCCTTTGGTTCCAGGGGAGATGTGTGAAAGTTGACCTGTCTGAAAAATATAAAAAATTGGTACTAAGGATTCCCAACAGAGGCATTGACTTACTGAAAAAAGATAAATCCCGAAAAAGATCTTATTCTCCAGATGGCAAAGAATCTCCTAGTGATAAGAAATCCAAAACTGATGGTTCTCAGAAGACTGAAAGTACAAATGAAGGTAAAGAACAAGAAGAGAAGTCAGGTGAAGATGGTGAAAAAGATACAAAGGATGACCAGACAGAACAAGAACCTAGCATGCTTCTTGAATCCGAAGATGAATTACTCGTAGATGAAGAAGAAGCAGCAGCACTGCTAGAAAGTGGCAGTTCAGTGGGAGATGAAACAGATCTTGCTAATTTAGGTGATGTGACTTCTGATGGGAAAAAGGAACCTTCAGACAAAGCTGTGAAAAAAGATGGAAGTGCTTCAGCAGCTGCAAAGAAAAAGCTTAAAAAGGTGGACAAGATCGAGGAACTTGATCAAGAAAATGAAGCAGCGTTGGAAAATGGAATTAAAAATGAGGAAAATACAGAACCAGGCGCTGAATCTGCTGAGAATGCTGATGATCCCAACAAAGATACAAGTGAAAATGCAGATGGCCAAAGTGACGAAAACAAGGAGGACTATACAATCCCAGATGAGTATAGAATTGGACCGTATCAGCCCAATGTTCCTGTTGGTATAGACTATGTGATACCTAAAACAGGGTTTTACTGTAAGCTGTGTTCACTCTTTTATACAAATGAAGAAGTTGCAAAGAATACTCATTGCAGCAGCCTTCCTCATTATCAGAAATTAAAGAAATTTCTGAATAAATTGGCAGAAGAACGCAGGCAGAAGAAGGAAGCTTAAGATGTACAAGAATCTTAATGATTTCAAAAGAAAATAATGGTTCTTTGTTTTTAATGTTAACTTTTTTAAAATACAATACTGATAGTTAGAAGAAAACTATTGTACTCTTTTGTTTTAGTGGAAAAATAATAGATGTCTGTTCATGTGTTAAGTGTTATAGCAAAAATGCATATACGGTTAAGTTAATGAAAAATTGTTTTTGTTTTATCGAAATGGTAACAGACAGAAGTACTTGTAGAGACTGACTTCGTAAACTACTTAAGACAACTTGCACCACTAAGAAAAAGATACGTAGAACTATTCAAAGAAATGAAATTTAGTAGTTCTAAGCTTCAAAGAAATGTCAAAACTTTTGATTCCATTCAATAAAGAACAAAACCAATTGTATTTTTATTACTTTCATCTGAAACATTCCACATTTTAATCTGAGCCTTGTAGACTTCTCATTTGGAGTTTGAAGCTTTTTTGGTTACATTTCATTTTCGGAGAACTTCATTAATGTGTGATTAGCAATTAAAATGCAGGTGCAGTTTTCTTTTAATGTTATGCTGTTGCTTAGGTAATAAGAAATATTAAGTAATTGGCTTTAGATTTTGTAATTTTTTCCCCTAAGTTCCTGCTAGATTTCGTATTCTAGTAGTCAATGTATTTTCAGTGAAATGTAAAAATACTCCCATTCTCTTTGACCAGTATTAATTTCTTGAAACCTTATTGCTTGTCACTTGAATCCTATAGCTGTCATACATCTGGTATAAGCAACATTTGATTTTTGAAGTGTGTAGACCATCTCTTCATATTTTCAAGATGTAATTTTACATTTCTGCATTTTAAAAAGTTTGGCCATAAGCTAGACGCACGCTTCTAATTCATATACCTGCACATGTGATCTTTGTGAACAGAAATTTGCATGTATAATCTGTGTTTACTTGTAACTTTCTGGTTATATACTGCTTATATCTGTGGATTCAAGTTTCTGAAGTGAATACCAATAAAAAAAAAACCTAGGCCATGTTCATTGGTTATACATGTTTGGAATGTTAACCAATATATTGTCAGTTGTGGTTTTTATTCACTGTTACACTTTTGCATGCTTTAACAAATTTTTACATTTTCAATCTAGAGTGTTCTGAAGATTGCTACTAAAGATATGAATTTTAAAGTTTTTGGTGCTGGTGGATTTCTTGTTCCTGTTACATAACAAAAGTGGGACTATTGGTTTTTTTAAACCTCAGGAGTTATAAATGCTAAAGACAAATAGCAAATGCTAATGTTTAGACATGTCGAAGTAGTTAACAGTAAAATTGAAAGTAACATGGTGGAATAGTAAGAATTCTAGCAGCCTTTCAAAATGTTGGGGGTCTTAGTATAAGGGAGTATCAGTTCTCAAATTTTTTTTAATTTAATAAGAACTTACAGGAATTCTTTTTGAAACTCTTAGTTCCAAGTGTATTAAAG