Transcript asmbl_61118

Sequence
Transcript Sequence for observation asmbl_61118 of TGE0002143:
CCCATGTGAGCGGATTGCAACACATGCAGCTGCCTGGAGAGAGGGAACCGGTGTCCTACGTCAGAGCCGCCGCCGCGGAGCCGCCGCCGGGGAGGAGCAGCCACTGCCGCCCAGGACTGGGCCCTTAGGGAGGAGGAGGCGAGAAGATGGCGGACGACCCCAGTGCTGCCGATAGGAACGTGGAGATCTGGAAGATCAAGAAGCTCATTAAGAGCTTGGAGGCGGCCCGCGGCAATGGCACAAGCATGATATCATTGATCATTCCTCCCAAAGACCAGATTTCACGAGTGGCAAAAATGTTAGCAGATGAGTTTGGAACTGCATCTAACATTAAGTCACGAGTAAACCGCCTTTCAGTCCTGGGAGCCATTACATCTGTACAACAAAGACTCAAACTTTATAACAAAGTACCTCCAAACGGCCTGGTTGTTTACTGTGGTACAATTGTAACGGAAGAAGGAAAGGAAAAGAAAGTCAACATTGACTTTGAACCTTTCAAACCAATTAATACGTCATTGTATTTGTGTGACAACAAATTCCATACAGAGGCTCTTACAGCACTACTTTCGGATGATAGCAAGTTTGGCTTCATTGTAATAGATGGTAGTGGTGCACTTTTTGGCACACTCCAAGGAAACACAAGAGAAGTCCTGCACAAATTCACTGTGGATCTCCCAAAGAAACATGGTAGGGGAGGTCAGTCAGCCTTGCGTTTTGCCCGTTTAAGAATGGAAAAGCGACATAACTATGTTCGGAAAGTAGCTGAGACTGCTGTGCAGCTGTTTATTTCTGGGGACAAAGTGAATGTGGCTGGTCTCGTTTTAGCTGGATCAGCTGACTTTAAAACTGAACTAAGTCAATCTGATATGTTTGATCAGAGGTTGCAATCAAAAGTTTTAAAATTAGTTGATATATCTTATGGTGGTGAAAATGGATTCAACCAGGCTATTGAGTTATCTACTGAAGTCCTCTCCAACGTGAAATTCATTCAAGAGAAGAAATTAATAGGACGATACTTTGATGAAATCAGCCAGGACACGGGCAAGTACTGTTTTGGAGTTGAAGATACACTAAAGGCTTTAGAAATGGGAGCTGTAGAGATTCTAATAGTCTATGAAAATCTGGATATAATGAGATATGTTCTTCATTGCCAAGGCACAGAAGAGGAGAAAATTCTCTATCTAACTCCAGAACAAGAGAAGGATAAATCTCATTTCACAGACAAAGAGACAGGACAAGAACATGAACTAATTGAGAGCATGCCCCTGCTGGAATGGTTTGCTAACAACTATAAAAAATTTGGAGCTACATTGGAAATTGTCACAGATAAGTCACAAGAAGGATCCCAGTTTGTGAAAGGATTTGGTGGAATTGGAGGTATCTTGCGGTACCGAGTAGATTTCCAGGGAATGGAATACCAAGGAGGAGACGATGAATTTTTTGACCTTGATGACTACTAGGTAGTCGACATGGGTCCGGCAAAATGTGCCTCACCCTCCAGCATCCAACCCAAGGAGCATACCCGTGGTGGAATCCAAACAGATCCCTGCCTTACAATTGGAACATTTCCAGAACTTAATCCATGAGCATTGGATATTGAAAAGAAAACCGAAACAAAACCAGACCCAACCCTACACTTTGGTTTGTCATGGTGTCAGCGCAGCAGCCTACAACTAAGTTCCTAAATGCCACTTTGGACTAATTTAAACAAGAATCCCAGTTTTTACTTTTACTCGATGGTGAAATTGGTTGCTCTTGTATTTTATGAAAAAAAAATGATTTTTTTAACCTTCATACATAGAAGCAAAAATACTTTAACTGCTGTAAACCTTCAAAAGTTAATAGAAATGAGATCATACTGGTTTGTTTCTTATTTTGATTGGAGAAAAATTAAATTGCTGCATTTCGCAGTGACCCATTTACATGGCATTCTCAGCTTAGACTGCATAAGAAGAAATATACGTGGTGAAATGTTGGAACCATTTCTCTCTTGGTCTCTTGTTTAATGTTGAAAGGGTGAGCTAATAGGCAATTTCAACTTCACTCCCTCACACTACCCGTGCCCCTACAGACTGTCAGTTTCAAGGATGCAAATTGCATTGCAGCGTCAAACTGACAACATGAAGCATTTGGGCCAGTGCACCGTTTCCTTCCACGTGTTTTGCAGGCGCATTTGTGCCCAGGGTTTGGGAGCCCTTAGCATCAATTGCTTTGACAAGGGTTCTCATAATCTTAGCCTACTAGAAACCAGTTTGGGATGGATATGGGGCTTCTGTGCTATTGCTGGGATTGGGAGAAATAAAACATGCAATATAAATGGAAGCAAAGAAATTTAAAGAATATTTTATTTTGCTTGGGTCTATCCTTGGTCAAAGGGAGGTGGTCGTGTTTTCCTTGTGTTGGATGGCATGAGATTATGTGAATGTTTTGATTTTTTAAAAAAAATGAACTGCAAGGTTTTTCACAGGAACGACAGACAAGACACGTATGACTGTGCATGTAATTATAAGCCCCTGACCTCCTGGTGGGGTTGGAGCATCTGTTTCGAATATGGGACTTGTAAACACCTCTCAT