Transcript asmbl_60548

Sequence
Transcript Sequence for observation asmbl_60548 of TGE0006944:
GCCATTTGCTGGGTCCTGGAGGGAGGCGGCGGCCGCGTAGTCTTTCCTGCCCCTTGTCCGCCTCTTCTTCCTGCTCGCGGCCCGCCCGCCGGCTCGCACCCAGCCGCAGCGGCGTGGACGGAGGATACGACTGGGACGGCGCCGGGAGCCGAGGTGCTGAGGGACGGTGGCCGACTTAGGAGAGATGCTGGGCGTGGCGGCAGGAATGACCAACAGCAACATGGCCAATGCCCTTGCCAATGCTGCTTGTGAGCGCTGCAGGGGGGGTTTTGCACCCGCCGAGAAGATTGTAAACAGTAATGGCGAGCTGTACCATGAGCAGTGTTTTGTGTGTGCTCAGTGCTTCCAGCAGTTCCCAGAAGGACTCTTCTATGAGTTTGAAGGAAGGAAATACTGTGAACATGATTTTCAGATGCTCTTTGCTCCTTGCTGTCATCAGTGTGGCGAATTCATCATTGGCCGAGTTATCAAAGCCATGAATAACAGCTGGCATCCTGAGTGCTTCCGCTGTGACCTCTGCCAGGAAGTGTTGGCAGATATCGGGTTTGTCAAGAACGCTGGGAGACATCTGTGTCGCCCCTGTCATAATCGTGAGAAAGCCAGGGGCCTTGGAAAATACATCTGCCAGAAATGCCACGCCATCATTGATGAGCAGCCTCTAATATTCAAGAACGACCCTTACCATCCAGACCATTTCAACTGTGCCAACTGCGGGAAGGAGCTGACTGCTGATGCTCGGGAGCTGAAAGGAGAACTGTACTGCTTGCCGTGCCATGATAAAATGGGGGTCCCCATCTGTGGTGCCTGTCGACGGCCCATTGAAGGGCGTGTGGTAAATGCCATGGGCAAGCAGTGGCACGTGGAGCATTTTGTTTGTGCCAAGTGTGAAAAACCATTTCTTGGACATCGCCATTATGAAAGGAAGGGCCTGGCATATTGTGAAACCCACTATAACCAGCTATTCGGTGATGTTTGTTTCCACTGCAACCGTGTTATAGAAGGTGATGTGGTTTCTGCTCTTAATAAGGCCTGGTGCGTGAACTGTTTTGCCTGTTCTACCTGCAACACTAAGTTAACACTCAAGAATAAATTTGTGGAGTTTGACATGAAACCTGTCTGTAAGAAGTGTTATGAGAAATTTCCACTGGAGCTGAAGAAAAGACTTAAGAAACTAGCTGAGACCTTAGGAAGGAAATAATTTCCTTTATTATTTTCTTCTTTGCAAAGATCAGAGATTACCAACATTATTGATGTGATCTACCCTTATTTAAACCTATTTCTCAAAATAGTTGAGAGTGAAGAAAACCTACATGGTTTTCTTCATCTCTTTTTTTCTCATTAAAAAAGAAAATA