Transcript asmbl_58064

Sequence
Transcript Sequence for observation asmbl_58064 of TGE0003118:
AGAAAGAGTCCCGGCGCGCCAGCAAAGGGCTGAGCTGGGCGGAGCAGCTGAAAATCCGGCGCGCGCAGTCTCCAGCCCCAATTTCTACGCGCACCGGAAGACGGAGGTCCTCTTTCCTTGCCTAACGCAGCCATGGCTCGTGGTCCCAAGAAGCATCTGAAGCGGGTGGCAGCTCCAAAGCATTGGATGCTGGATAAATTGACCGGTGTGTTTGCTCCTCGTCCATCCACCGGTCCCCACAAGTTGAGAGAGTGTCTCCCCCTCATCATTTTCCTGAGGAACAGACTTAAGTATGCCCTGACAGGAGATGAAGTAAAGAAGATTTGCATGCAGCGGTTCATTAAAATCGATGGCAAGGTCCGAACTGATATAACCTACCCTGCTGGATTCATGGATGTCATCAGCATTGACAAGACGGGAGAGAATTTCCGTCTGATCTATGACACCAAGGGTCGCTTTGCTGTACATCGTATTACACCTGAGGAGGCCAAGTACAAGTTGTGCAAAGTGAGAAAGATCTTTGTGGGCACAAAAGGAATCCCTCATCTGGTGACTCATGATGCCCGCACCATCCGCTACCCCGATCCCCTCATCAAGGTGAATGATACCATTCAGATTGATTTGGAGACTGGCAAGATTACTGATTTCATCAAGTTCGACACTGGTAACCTGTGTATGGTGACTGGAGGTGCTAACCTAGGAAGAATTGGTGTGATCACCAACAGAGAGAGGCACCCTGGATCTTTTGACGTGGTTCACGTGAAAGATGCCAATGGCAACAGCTTTGCCACTCGACTTTCCAACATTTTTGTTATTGGCAAGGGCAACAAACCATGGATTTCTCTTCCCCGAGGAAAGGGTATCCGCCTCACCATTGCTGAAGAGAGAGACAAAAGACTGGCGGCCAAACAGAGCAGTGGGTGAAATGGGTCCCTGGGTGACATGTCAGATCTTTGTACGTAATTAAAAATATTGTGGCAGGATTAATAGCATTTTGGTTTT