Transcript asmbl_58438

Sequence
Transcript Sequence for observation asmbl_58438 of TGE0006784:
CTGCAGAGCGGGCCGGCGGCCATTTTGTGAAGCGGCGGAGGAGGTGGTGGCTGCTGTGGGCTCCGGGAAGCTGTTCGCGCAGGGGCTGTCGGCCGCGGGGCGAAGGCACTCGCGCGGGGGGTAACTCGGGTCTGGGTTCAGGTGCCGCGCAGCTCTCCCCGTCTAAAAGTTGGTTTTAATTGGTTGCCCACAGGATTGACTTGGCCTCTACTTCTTGTTAAGAAAATACATCTCTTGTTTTATCAGATGGCCCGCTGCGTGACCTTGGTTCAACTGTCCATTTCCTGTGACCACCTCATCGATAAGGACATCGGCTCCAAGTCTGACCCACTCTGTGTCCTTTTACAGGATGTGGGAGGGGGCAACTGGGTTGAGCTTGGCCGAACTGAGCGAGTACGGAACTGCTCGAGCCCTGAGTTCTCCAAGACTCTGCAGCTTGAATATCACTTTGAAACAGTCCAGAAGCTCCGATTTGGCATCTATGACATAGACAACAAGACACCTGAGCTGGGGGATGACGACTTCTTAGGTGGGGCTGAGTGTTCCCTAGGACAGATTGTGTCCAGCCAGATAATAACTCTGCCTTTGATGCTGAAGCCTGGAAAACCTGCTGGGCAGGGGACCATCACGATCTCATCTCAGGAATTGAAGGATAGTCGTGTAGTGACCATGGAGGTGGAAGCCAGAAACCTAGATAAAAAGGACTTCCTGGGGAAATCTGATCCATTCTTGGAGTTCTTCCGCCAGGGTGATGGGAAATGGCACCTGGCATACAGATCTGAGGTAATCAAGAACAACCTGAACCCTGCATGGAAGCGCTTCTCTGTTCCCCTTCAGCATTTCTGTGGGGGAGACCCTAGCACACCTATCCAGGTACGATGCTCAGACTATGACAGTGATGGTTCACATGATCTCATTGGTACCTTCCACACCAGTTTGGCCCAGCTGCAAGCAGCCCCAGCTGAGTTTGAATGCATCCACCCTGAGAAACAGCAGAAAAAGAAAAGCTACAAGAACTCTGGAACTATTCGTGTCAAGATTTGCCAGGTAGAAACAGAGTATTCATTCCTCGACTATGTGATGGGAGGCTGTCAAGTCAACTTTACTGTGGGTGTGGACTTCACAGGCTCCAATGGAGACCCCTCCTCACCAGACTCCCTGCACTACCTGAGCCCAACAGGGGTCAACGAGTACCTGACAGCACTGTGGAGTGTGGGAAGCGTGATTCAGGACTATGATTCGGACAAGCTGTTCCCAGCATTTGGATTTGGGGCTCAAGTGCCCCCTGACTGGCAGGTCTCCCATGAATTTGCTTTGAACTTCAATCCCAGTAACCCCTACTGTTCAGGCATCCAGGGTATTGTGGATGCCTACCGTCAGGCCCTGCCCCAAGTTCGCCTCTATGGCCCCACAAATTTCGCACCCATCATCAACCATGTGGCCAGGTTTGCAGCCCAGGCTGCACAACAGAGGACTGCCTCGCAATACTTTGTGCTGCTGCTGCTAACCGACGGTGCTGTGACAGATGTGGAGGCCACACGTGAGGCTGTGGTTCGTGCCTCCCACCTGCCTATGTCAGTGATCATCGTGGGTGTGGGCGGTGCTGACTTCGAGGCCATGGAGCAGTTGGATGCTGATGGTGGACCCCTGCGCACACGCTCCGGGGAGGGAGCTGCCCGTGACATAGTGCAGTTTGTGCCCTACCGCCGCTTCCAGAATGCCCCTCGAGAGGCATTGGCGCAGACTGTGCTCGCAGAGGTACCCATGCAACTGGTCTCCTACTTCAAGGCCCAAGGCTGGGCCCCATTCAAGCCGCTTCCACTCCCAGCCAAGGGCCCTGCAGAGGCTCCTCAGGCCTAGATTCCCTTGGAGCGTAGGTTATGGCCAGTCCTCAGCCCTGTGTCCCCACCTCTGAACACACTTGCCAGTGCTAGCAGTTTATATATTTTATACTTTTATACTTGCTCCTGCTATTGCTGCTCTTGATCCCACCTGCTTGCCCCCTGGAGCCCTTCATTCAATAAAGATCAACGATGACCA