Transcript asmbl_58357

Sequence
Transcript Sequence for observation asmbl_58357 of TGE0006772:
AACCTCAATACCTTAGCTTCTACTATGATGGTAACATTTTTCGTCAACAGCAGTTCACCTAGTGAGTGATGATACTTTGGGTCTGAGTGAAGCTGAGGATAGAGGAAAATACTGGGGATGGGGAGTAGTTTGTCCCTTTAGGAGCTGACAGGCTTTGTTCACCCCTACACATACATACATTCAGAGGTGCCCACAAGTGTATTTGGGGAGAAGCTTCGAGAACAAGTGGAGGAGCGGCTATCCTTCTATGAGACCGGAATTTTTCCACGGAAGAACCTGCAGGTTATGAAGGAAGCCATGGTTCAGGCAGAGGAGGCGGCTGCTGAGATTACTAGGAAGCTGGAGAAACAGGAGAAGAAACGCTTGAAGAAAGAAAAAAAACGGTTGGCCGCCATTGCTCTTGCATCTCCAGAAAACAGCACTAGTACGCCAGAGGAGTGTGAGGAGATAAGTGAAAGACCCAAAAAGAAGAAAAAGCAAAAGCTCCAAGAGGCTCCTCAGGAGAATGGAATGGAAGAGCCACCTGTCTCTTTAGCCAAACCCAAGAAAAAGAAAGCTTTTTCCAAGGAGGAGCTGATCAGTAGTGATTTAGAAGAAACAGCTGGCAGTGGAAGTCTTCCCAAGAGGAAGAAATCTTTCCCCAAAGAAGAACCAGTTAGTGACCCTGAAGAGGCAGAAAACAGGAGTGTCCCTAAAAAAAAGAGGAAATTTAAGGAGGAGCTGCTCAGCAGTGGACCTGAAGAAGCTGCTAGCAGCAAGAGCAGTAGCTCCAAGAAAAAGAAAAAGCTGCAGAAGCTATCCCAGGGAGATTAGAATGGACAGTGCCCTGGTGGGACATAACCACCCACAGTGACATTTCCCAACCCATCCCTTATATCCCAATAAAAACATTCACAAGCTGA