Transcript asmbl_57087

Sequence
Transcript Sequence for observation asmbl_57087 of TGE0022649:
CTCCGGGGCGCATGCGCCTCGTCTCCACGGTACTTGAAGTAGTTTCCTCCGCCGGCGTCTCGGGACCCCGGCTCTCAGGATTCCGGTTCGCGGCTTCTCGCCCTCTCCCCTTCCTCGGCGCAGCGGCTTCGCAGGCTCCAGAATCCTCCTGCTCCTCGCAGCCGGCCTCCCTCCGCGGCGCGACTCTCAGGGCCACGATGAGTTTGTTTGGAACAACGTCAGGTTTCGGAACTGGTGGGACCAGCATGTTTGGCAGCACAACCACGGACAACCACAACCCTATGAAGGATATTGAAGTAACATCCTCTCCTGACGATAGCATCGGTTGCCTGTCTTTTAACCCACCAACGTTGCAGGGGAACTTTCTCATTGCAGGATCGTGGGCTAACGATGTTCGCTGCTGGGAAGTTCAGGACAGTGGGCAGACGATCCCTAAGGCCCAGCAGATGCACACGGGGCCTGTGCTGGGGGTGTGCTGGAGCGACGATGGGAGCAAAGTATTTACGGCTTCGTGTGATAAAACTGCCAAAATGTGGGACCTTAACAGTAATCAAGCCATACAGATTGCACAGCACGATGCTCCTGTTAAAACCATCCACTGGATCAAAGCACCAAACTACAGCTGTGTGATGACCGGGAGCTGGGATAAGACGCTGAAGTTTTGGGATACGCGATCATCAAATCCTATGATGGTTTTGCAACTCCCTGAAAGGTGTTACTGTGCCGACGTGATATATCCTATGGCCGTGGTGGCCACTGCAGAGAGAGGACTGATTGTCTATCAATTAGAGAACCAACCTTCTGAATTCAGGAGGATAGAATCCCCACTGAAACACCAGCATCGATGTGTGGCTATTTTTAAAGACAAACAGAACAAGCCGACTGGTTTTGCCTTGGGAAGTATCGAGGGGAGAGTTGCTATCCACTACATCAACCCCCCGAATCCAGCCAAAGATAACTTTACCTTTAAATGTCATCGATCTAACGGAACCAATACTTCAGCTCCTCAGGATATCTACGCGGTCAATGGAATCGCGTTCCATCCTGTTCATGGTACACTTGCCACGGTGGGATCTGATGGCAGATTCAGCTTTTGGGACAAAGACGCCAGAACAAAACTTAAAACTTCAGAACAGTTAGATCAACCGATATCGGCTTGCTGCTTCAATCACAATGGAAACATATTCGCATATGCTTCCAGCTACGACTGGTCAAAGGGACATGAATTTTATAATCCCCAAAAGAAAAATTACATTTTCCTGCGTAACGCAGCCGAAGAGCTGAAGCCCAGGAACAAGAAGTAGGGGAGCCTCCTGGCTGCCACAGCGCCTTCCTCTCCACTCTGCCTCGTCTCACGAACTTGGGTCCCAGCTTTTTGTGGGTTCAGCCATGGATGTGGATTCCAACCCTCGGGGAAAACTGTCATTGTTTGGCAGTCGGGCCCAGCGGGCCACAGTGACCGTTGGTCTCTCCATTCCACTGCCCATTACAGACGTCTCTGGAACTGTGAGGGGGTTGGAGTCGCTGTAGAAGTTAGGTCCCTGCGGGCGACTGCCAGGCATTCGCAGTCTTCGCTCAGCAGCGTGTGTATAGAGAACACTGGGAATCATTTTGTGAACCCTGGACTGTATTTTGTAATAAAGCATTTCGAAGATTGTCTCCTAAGCTCACTGTGTCCACCTTGCCCGCCCG