Transcript asmbl_56888

Sequence
Transcript Sequence for observation asmbl_56888 of TGE0006675:
GTACGCGTGAGGTCATCGCGCGGGCGGGCGGGGTCGGGCGGTTTGAACGAGACGAAGACGAAACCGGAGCCGGGCACGGGCAGTGGACGCGGTTCCGCTGAGAGCCGAAGATGGCAGTGAACGTATATTCAACATCAGTTACCAGTGATAATCTAAGTCGACATGACATGCTGGCCTGGATCAATGAGTCTCTGCAGTTGAATTTGACAAAGATAGAACAGTTGTGCTCAGGGGCTGCCTATTGTCAGTTTATGGACATGCTGTTCCCTGGCTCCATTGCCTTGAAGAAAGTGAAATTCCAAGCTAAGCTAGAACATGAATACATCCAGAACTTCAAAATACTACAAGCAGGTTTTAAGAGGATGGGTGTCGACAAAATAATTCCTGTGGACAAATTAGTAAAAGGAAAGTTTCAGGACAATTTTGAATTCGTTCAGTGGTTCAAGAAGTTTTTTGATGCAAACTATGATGGAAAAGACTATGACCCTGTAGCTGCCAGACAAGGTCAAGAAACTGCAGTGGCTCCCTCCCTTGTTGCTCCAGCTCTGAACAAACCGAAGAAACCTCTCAGCTCTAGCAGTGCAGCTCCACAGAGGCCCATTGCAACACACAGAACTACTGCAACCCCTAAGGCTGGCCCGGGTGTGGTGCGAAAGAATCCTGGTGTGGGCAATGGGGATGACGAAGCAGCCGAACTGATGCAACAGGTCAACGTATTGAAACTTACCGTTGAAGACTTGGAGAAAGAGAGAGACTTCTACTTTGGAAAGCTAAGGAACATTGAATTGATTTGCCAGGAGAATGAGGGGGAAAACAACCCTGTATTGCAGAGGATTGTGGACATTCTCTATGCCACAGATGAAGGCTTTGTGATACCTGACGAAGGGGGTCCACAGGAGGAACAAGAAGAGTATTAACAGCCTGGACCAGCAGAGGAACGTTGGAATTTTTCACTCCAAATCATGTGCTTAACTGTAAAATACTCCCTTTTATTATTCTTAGAAGACTCACTGGTTTCTTTTCATAAGCAAAAAGTACCTCTTCTTAAAGTGCACTTTGCAGAAGTTTCACTCCTTTTCCAATAAGTTTGAGTTAGGAGCTTTTTACCTTGTAGCAGAGCAGTATTAACATCTAGTTGGTTCACCTAGGGAACAAAGAGGCTGACCATGGGGCTCACCGAATGGATACTGGTAACACTGATTACTGGAGAAGGTGTTTTTATGTGATATGCTGAGGTGGAGACCTCAGAGAAAATGTAAAGACTGATTTGAATTTTAAGCTAATGTGAAATCTTGGCAGAGAACGTTTTAATAAATAAATGCCTTAAGAGTATTTAAAATATGCTTCCATATTTCAAAATATAAAATGTAACCTGACGGGATTTTGTGTGTTCAACCTTGTGTCTGGAAAGGAAGGGCCAGACCTTGGAACCTTTGGAACCTGCTGTTCACAGGCCTTGCAGGGCAGCTTGAATCTTCACAGGCCTAACCTTGGCCCAGAAGGGAAGTTTAAAATGTTGCTCTGTAAAGCCGTGTGGTGTCCTTGATCAATTGCATCTCTGCTAGGAAGCAAGAGGCGTTGCCTGAATGAATAAGAGTATGTTTTAGTCCTGAGATGTTTGAGTTGAATAGCTCGATTTTCATTGAGCATTTCTCTGACGATTTTTCCAATTACCCCTGAAATTTCTATGTATTGTGTTTATTTTTGGGAAATGAGGTGTGTTCAGTTTTTAAATCTAACAACTACTTTTTGGGACTTGCCCACATCTCTGGGATTTGAATGGGGGTTGTGTCCCATTTTACTGTTTTTTTAAGTTTACATTTAACATATTTCTCTTCTCTGCTCCCCTTGCCCACTGGGGACTCCTCTTTGGCTCCTTAAAGTTTGCTGCTTAGAGTGGAAGTTGAACAGGCAGGTGATCATGCTGCAAGTTCTTTCTGGACCTCTGGCAAAGGGAGTGACCAGTGAAGGCCATCGCTACCATGGGATCTGCAAGGCTGGGTGTTTTTGGTACCTGCTGTCCACAGCCTTCCACTGTTATCGGAATACTTTGCCAGTGCACTAATCTCTTTGGAGATAAAATTCGTTAGTGTGTTACTAAATGTTAATTTTCTTTTGCAGAAAATACAGTGCCATGTCTGAATTAATTATTAATATTTAAAATATTTCATTCCTTAACACTCCCTCATTTGCTTTGCCCACAGCCTATTCAGTTCCTTTGGCAGAATTCTGCAAAATGTGTGTCACCCACTACTGAGATTGTTCAGCCCCTGATGTATTTGTATTGATTTGTTTCTGGTGGTAGCTTGTCCTAAAATGTGTGTAGAAAGCCGGTATTTTATGATAAATTGTTGTGTAGTGCATGCTCTGTGTGGAATTCAGAGGAAAACCCAGATTCAGTGATTAACAATGCCAAAAATGCAAGTAACTAGCCATTGTTCAAATAACAGTGGTGCTATTTCTCTTTCGTGGCCTTTTAGACTTTTGTTGCCCTAAAATTCCATTTTATTGGGAACCATTTTCCACCTAGTCTTTCTTGACAGGGTTTTTTTCTACTTTAAACAGTTTCTAAATAAAATTCTGTATTTCAAGAGTGTCATGTCTTCTGAAATTTGTCTTGCCTTGGGTATTTTCTTTTAGGTTCAAATGATAAGGTATCGATGCTTCTTTCTTAAATTAGGACTGATCTTTTAAAAATCCTCAACTATTTTTTTTCAAATGTGTTTATTCCTAAGCCTGTTCTCTTTGTTCTGTATTTTTCATATTACATTTCTTAGCTTCCTGCTGTTTTACGTTCTTATATTACTGTAAGAGGTCTTTCAGAGGTCCAAGGCTTGACGTAGCTGCTGTGAAGCCTTTTAGCTCGTTTCCTCCTGAGATACACAGCAGGACCATGGCGAGATACTTTCTTTTGGTCTGTTTTTTTATTGAAGGTATGTTTCAAAGGCAGTGAACACCATCTTAATCTAGAAAATGAACCTGAAATTGTCACTATAAGAAATGAATTCAAAAGGAGACTTACTGCCATTTCAATATGAAATAAAGTTAAATGGGCAGAAGGCAGTTGTCTGTATTTTCTTCAGAGTAGTTACCAAAATTATGGATGCTCTGTAAACCCAATTCGATTTCGACTAGGGTTACACTCACATTATTTCCTCTAGAAAATGGTATGATATCTTTTCTGAAATGTTTTG