Transcript asmbl_56697

Sequence
Transcript Sequence for observation asmbl_56697 of TGE0006647:
GACGTAAGGGCGCTCCGCGAGCCCGTCTCCTCGAATGAAAGGAAACAACCTCCGGCGACAGAGCCCCGCTCTCAGGCGCTGCCGGAGAACCGAGACCGACTTCTTTCTCTTAACCCTCATTGGCGCTTCTCCTCTGCCGTTCGCCTCTGGGCCCCGCCGCATTTCTTGAGGCCTAAAGTGGCATTCTAAAGGCAATTTAAAAATCATGTCAAGCTCAGTTGAACAGAAAAAAGGGCCTACAAGACAGCGCAAATGTGGCTTTTGTAAGTCAAATAGAGACAAGGAATGTGGACAGTTACTAATATCTGAAAACCAGAAGGTGGCAGCACACCATAAGTGCATGCTCTTTTCATCTGCTTTGGTATCATCACACTCTGATAACGAAAGTCTTGGTGGATTTTCTATTGAAGATGTCCAAAAGGAAATTAAAAGAGGCATGAAGCTGATGTGTTCTTTGTGTCATTGTCCTGGAGCAACAATTGGTTGTGATGTGAAAACCTGTCACAGGACATACCACTACCACTGTGCATTGCACGATAAAGCTCAAATACGAGAGAAACCTTCACAAGGAATTTACATGGTTTATTGCCGGAAACACAAGAAAACTGCACATAACTCTGAAGCTGATTTAGAAGAAAGTTTTAATGAACATGAACTGGAGCCCTCATCACCTAAAAGTAAAAAGAAAAGTCGCAAAGGAAGACCACGAAAAACTAATTTTAAAGGGCTGTCGGAAGATACCAGGTCCACATCCTCCCATGGAACAGATGAAATGGAAAGTAGTTCCTATAGAGATAGGTCTCCACACAGAAGCAGCCCTAGTGACACCAGGCCTAAATGTGGATTTTGCCATGTAGGAGAGGAAGAAAATGAAGCAAGAGGAAAACTGCATATATTTAATGCCAAGAAGGCAGCTGCACATTATAAGTGCATGTTATTTTCTTCTGGCACAGTCCAGCTCACAACAACATCAAGAGCAGAATTTGGAGATTTTGATATTAAAACTGTACTTCAGGAGATTAAGCGGGGGAAAAGAATGAAATGTACACTTTGCAGTCAGCCCGGTGCTACTATTGGATGTGAAATAAAAGCCTGTGTTAAGACTTACCATTACCACTGTGGAGTACAAGACAAAGCTAAATACATTGAAAATATGTCACGAGGAATTTACAAACTGTATTGTAAAAATCATAGTGGAAATGATGAGAGAGATGAAGAAGATGAGGAACGAGAGAGTAAAAGCCGGGGAAAATTAGAAATTGATCAGCAACAACTAACTCAGCAGCAACTTAATGGAAACTAGGTATGAAAGTTAATTATATCGGATCTGTTGTCAGAATACAATACACATTGATAAAAACATGTTGAAATAATGGTGTGCAGTATGATTTTTTAATGCTATTGTGTTTAGTTAAGCATGTTATTAGAATACTGAGGATTGTGTAGGCTTGCATAGTTTTTTAAACTAGCTGATTTTGTAACAATAAAAACAAGCTATCCAATTTATCAATAAATGTAGTTGTAATGTCAAATCAGTAAGATATTCTCGCTCCCCAATAACATTATATTTATTGTGTTCCCCTCAAGCATCATATTTTACATTTTTTTATCATCTTTTAAACAGGTTCATGGGACAGAGTTAGAAAACTGGGAATGAATAAGACATCCATAACTACTATTCTTTTTTCACTGTTTTCTAAAATCAAAAAGGGTTTGTAACTTTTTACTGCCCAACTCTTAGATCCTTCATTGAACTGCCTAAAAACGTCTTGTTTTATGAGCCTTCTTCACTAGATGGCAGAGTTTGACATGTTGATATTACGTAGCTGTAGTTTGCAGTTTCTGGGAAGCGATTGAAACACTATTAACCCTGTGTATAGTGTCAACAGTTAAAGCAGACATTGAAATGAAGTAAGCTATATTTCTGGACCGAACAAAGTTCTGCTGTTTAGAGTGTCTAAGTTTGCTTAGTGGATTCATACTCAAAGGAAAGTATAAGCAAATTTCACTTAACAGTGCAAACATGCCTCTGGTGGCAACATGTGGGAATTTGTGGAATTTTTTTTCACACGCAAGTAATGGAGGCTAGAAATGAAGAGAACTTTATTTTTCCCTTGGCTTTGACAGCAAATGCTTAAAATCTCTTCCAAGAAGTGTGCTAAGCTTTTCATTTGGTTCCTGTTAAAGTTGTTCTCACTGACCAGCATGGACTTGGGCAACTGGTGATTATAAGCTATGAGCTCCAGTGCTTATGCCAAAATTATCTTGACAGTAAACCTCTTTTCTTTTCATGTCATACAAAGAGCTTCTAGCAAAATGATTGGATCCTTTCGAGTTTAAACTAACATTTGGCGACAGCAAATTAAACCTCTTTAAGACTCACTAAGGACTTTAGCCACCATGTCTGAAACCTGTTCCTCTCAAGTGCCGTGTTGTGTGGAACACTTCTTATATTGGCCCAAAGTATGTAAGGAGGTCTCATGTGCTCTAGGAGTAAAAAAACAGTCTTCGCATAAAACAGTATTTATTTTTAATTTTGTGACCACTATTTTAGAAACTTTATTTAATGTTTTTAATGTTTCATTCAGTGCTTTGCTTATCTAGTAAATAGGCTTTTGTGCCCTACTTTTCCTCTGGTAGGGCTTGCTGTTGTACTATTGATCATCAGAATTGTTTCTCAAAGCCTAAGAACCCAGCATTTTAGAAAGGATTTTCACACTGGCATTTCTAGCTAGTGTTATTTTCTTCCACTTACTTGCTGAAGCACATTTATATATTTCTTCATGGCAAAACCAAAAAACTTTAGTTGTGGTCTGCCTAATATTACCATAGCACCTCATTTATCAAGGGTAGGGATTCTGATCATTGAATTATTAGTTAATTAAATTAAATCAGCAGGCAAATAATCATGTTAACTTGACTGCACATCAAGATATTCTACAGCTTATGGAAAAGCATTTTAAAAATGTAACAGGTGGAAAATTACACTGTGCTTAATGACTGATTTTTTTTTAACTGCTAGTCCCTTAAAGTCATATTTGTCAAGTGTGTATTCACACATTTACTTAAATCAAGGGACTCGATTGCTTTATTTTAATCATCTTTTATTATTTTTAGAAGGAAACTAGCTTTAGTAGTGAGTTGTCTTCCCTATATGTTTTTCTCTTCTTGCTCTAAATATGCCATTGGGTTTCTTTGTGTGTATGTGATGAATTTTCAAAATTCACCGTGACTTGAAGTGCAACGACAGATCTAGATGTTTGTTTACCAAGCTATGTGACTTTTCCCAAAGGATCTGTACTTTATTTCCTTACAACAGCTTGAAACCCGTTATTTTAAATCTTTGAATCACTGTGTCTAGATCATTTTTACATTGTGTGCCATTGATTTACCCGTGGAACTATAGAGCACCTTCATTTTTGGACAACTACTGTAATGATGTTTTTAGGAAAAATAGAAGGTGCCAGGGGTAATAATGGCCAGTCAATAATCACATAATGGACTTCAAATACTATAGCTGTCAGTTGATGGATTTGTTATGTAATAAAGTGTATGATTTTTGTATGGGTTTCTTCAACCCTTTCTGCCACTAGCAACCAGAATAGCACTTTTACCTTTTGGTTGGCTAGGTAAGTGGCTGGCTACCTATTTTTCTCACTGTGGTGTGATTGGCTAAATAGTCTTTCATTAAAAATTAAAATGTAAATTGAAGTCACACGAAAAATCATGTTTGGTTGTAAACCGCCGATATTTTGTTTTTCTATCTATGTTTTCGTCACATGCTGAGTAAAAGTGCCTTACAATGTAAAAATTGTACAGTACTTATGTTCTCAAGTAGCATCATCATCTTCTGGGTAGTAATTACATTGTGGTATGAATATTTAGAAAAATGGACCTCAGCAGTGTATTTACTGTTCATCTCTTAAGTCCTTAACTGTAGTTTTAATAAGCATGACATTATTTGATAAGTATATAACATTTACATCATTTCAAAAAATACTGCCATGACTGTCTTTTATGCATATTTTAGCTTGAAATTTTGAAGCATCTTTACTGTTTTCCTTTTTTCTTTTTTCCTTT