Transcript asmbl_56671

Sequence
Transcript Sequence for observation asmbl_56671 of TGE0006642:
GGCGCACGTCGGTAGTCAGCTGCCGCGGCCTGGGGCTGGGATGTGACGGACTGCTGGTCCCGTCAGTGGCGTCTTCCCTGAGCGGCGGTGACTGCGGCGAGGGCGGCGTGGACAAGGCCAGCGGGCGCCATTGGCGACCGGCCGTGTCGGCCGCGGGATGAGGAAGCGGACCGAGCCCGTCGCCTTGGAGCATGAGCCCTGCGCCGTCTCGGGCTCGACTTCCTCCGGCTCGGCCGCCGCGGTGCTGGACACCGACTGCAGCCTGAAGCGGAAACTGTGCCTGGCGGGCAGGGGACCGGGCGAGACGCGCAGCGCCGCGGACGCGGACATGAAGCGGGCGCTAGGCAGGCGAAAGGGCCTGTGGTTCCGACTGAGGAAGATACTTCTCTATGTTTTGGGGTTATACATTGCCATTCCATTTCTCATCAAACTATGTCCTGGGATACAGGCCAAACTGATTTTCTTGAATTTTGTGAGGGTTCCCTATTTCATTGACTTGAAAAAACCACAGGATCAAGGTTTGAATCACACCTGCAATTACTACCTCCAGCCAGAGGAAGATATAACCATTGGAGTCTGGCACACTGTCCCCACTGTCTGGTGGAAGACTGCCCAAGGGAAGGACCAGATGTGGTACGAGGATGCCTTGGCTTCCAGTTACCCTATCATCCTGTACCTGCATGGGAATGCAGGTACCAGAGGAGGTGACCACCGAGTGGAACTTTACAAGGTGCTGAGTTCCCTTGGTTACCACGTGGTCACTTTTGACTATAGAGGTTGGGGTGACTCAATAGGCACGCCATCAGAGCGGGGCATGACCTATGATGCACTCCATGTTTTTGACTGGATTAAAGCGAGAAGTGGAGACAACCCCGTGTATATTTGGGGCCACTCCCTAGGCACTGGAGTGGCAACAAATCTGGTGCGGCGCCTCTGTGAGCGAGAGACACCTCCAGATGCCCTAATATTGGAATCTCCATTCACCAATATTCGTGAAGAAGCTAAGAGCCATCCGTTCTCAGTGATATATCGATATTTCCCTGGATTTGACTGGTTCTTCCTTGATCCCATTACAAGCAGTGGAATTAAATTTGCAAATGATGAAAATGTGAAGCACATCTCCTGCTCCCTGCTCATCTTGCACGCTGAGGATGACCCAGTTGTGCCCTTCCAGCTTGGCAGAAAGCTCTACAACATTGCTGCACCCTCTCAGAGCTTCCGAGACTTCAAAGTTCAGTTTATCCCCTTTCACTCAGACCTCGGCTACAGGCACAAGTACATCTACAAGAGCCCTGAGCTTCCTCGAATACTAAGGGAATTCCTGGGGAATTCGGAACCTGAGCACCAGCACTGAGCTCACTGCTTGAAGGAGCATGAAGACCTTTGCCCTCCTCCCCATTCCTCCAGCCAACCCAGCACCGTGGAGCAAGGGTACCAGCGTCTGTGATGCACCTGGAGAGAGGACTCGGATGCCATCTAGGGCAGGAAGAGGAGGCCACAGCAGACTGGTGGCCAGGAGCATAGATCTTTGTGGAAAATGCGAGTGGCAGGCATGTGGCCCTCTCTCCCTCTTGCTGCCACTCAACCTGAGTTCTTGGAAGGACAGTGACACAGCAGGCAGCAACCAGCAGGTCGATCCCACACTTCTTGAGCTGGGTATGGAGAATGAGGCAGGAAGTATGAAGTCTTGGGACCACACTGAGCTATCCGGTACCACCCATGAGAATGTGAGGACACTTGGGTTCTTCTGTCCCTTCCCAGCACATGCAGAATGGACTCTGTTGGTTCCATAGCCCCTTCCTGCCCTCTGCACCCCCACTTGCCTTCCTTGGTGTCCCTGCCTCCCTTGGCAGGCCCACCACTCACAGAGAGGGAAGTGCCCACGATCTGCACTTCCTCCACTTTCCACCCACCTGTTCACCTGAGCGTTTATTTAATAAAATCCTAGTGGTGGTCTGTC