Transcript asmbl_5617

Sequence
Transcript Sequence for observation asmbl_5617 of TGE0006634:
CGGGGCCGCGCAGGCGCAGTTATGCGGTAGGTTCCCAAGATGTCGTTCCCCAAGTACGAGCCGTCGCGCCTGGCCACCTTGCCCTCTACCCTTGACCCAGCTGAGTATGACATATCCCCGGAAACCCGGAAGGCGCAAGCCGAGCGGTTGGCCATAAGATCTCGGCTGAAAAGAGAGTACCTGCTGCAGTACAACAACCCTAGCCGCCGAGAGCTCATTGAAGATCCTGCCTTGACTCGTTGGACCTATGCAAGATCTGCAAATATCTATCCCAATTTCAGACCCACTCCCAAGACCTCACTCTTAGGAGCTGTTTTTGGATTGGGGCCCCTTTTCTTCTGGTATTATGTTTTCAAAACTGACAGAGATAGGAAAGAAAAACTTATTCGGGAAGGAAAATTGGATCGAACATTTAACATCTCATATTAATTCTGGCAATGATGACTATGTGTATTATGTTTAAATAAATCTATTAATCATTAAATAGTTTTTCTTTCTTAATGTTACCTTAATTCAATAAAC