Transcript asmbl_55602

Sequence
Transcript Sequence for observation asmbl_55602 of TGE0022612:
CTGAAAAGCCCCGCTGGCCTCCAGGTGCTCAACGACTACCTGGCGGACAAGAGCTACATCGAGGGGTATGTACCATCACAAGCAGATGTAGCAGTATTTGAAGCAGTCTCTGGCCCACCACCTGCCGACTTGTACCATGCCCTACGTTGGTATAATCACATCAAGTCTTACGAAAAGGAAAAGGCCAGCCTGCCTGGAGTGAAGAAAGCTTTGGGCAAATATGGCCCTGCTAATGTGGAAGACACCACTGGAAGTGGAGCTACAGATAGTAAAGATGATGATGACATTGATCTCTTTGGATCTGATGATGAAGAGGAGAGCGAAGAAGCAAAGAGGCTAAGAGAAGAGCGCCTTGCACAGTATGAGTCAAAGAAAGCCAAAAAGCCTGCACTTGTTGCCAAGTCTTCCATCTTATTAGATGTGAAACCTTGGGATGATGAGACAGATATGGCTAAATTGGAGGAGTGCGTCAGGAGCATTCAAGCAGATGGCTTGGTCTGGGGCTCTTCTAAACTAGTTCCAGTGGGGTATGGAATTAAAAAACTTCAGATACAGTGTGTAGTAGAAGACGATAAAGTTGGAACAGATATGCTGGAGGAGCAGATCACTGCTTTTGAGGACTATGTGCAGTCCATGGACGTGGCTGCTTTCAACAAGATCTGAAATCCATCATGGATCATTACTCTTAAATAAAAGCTTG