Transcript asmbl_55493

Sequence
Transcript Sequence for observation asmbl_55493 of TGE0006607:
GTTTCCGCCATTTTTGAAAATTGAGAAAGTCCGGAGCTAGGAGTAATTGCAGCCGCGATGGCAGCCTTTGCTGTGGAACCCCAGGCGCCCACGCTGGGATCTGAACCAATGATGCTGGGTTCACCCACATCTCCAAAGCCAGGGGTTAATGCCCAGTTCCTACCTGGATTTTTAATGGGGGATTTGCCAGCTCCAGTGACTCCACAACCTCGAACAATTAGTGGCCCTTCAGTAGGAGTAATGGAAATGAGATCACCTTTGCTTGCAGGTGGGTCACCACCACAACCAGTTGTACCAGCTCATAAAGACAAAAGCGGAGCTCCACCAGTTAGAAGTATATATGATGACATTTCCAGTCCAGGACTTGGATCAACACCTTTAACTTCAAGAAGACAGCCAAACATGTCATTAATGCAGAGTCCTCTTGTTGGAGTTACGACAACTACTCCTGGGATAGGGCAAAGTATGTTTAGTCCAGCAAACATTGGACAACCACGAAAGACAACGTTATCTCCTGCCCAGTTGGATCCTTTTTATACTCAAGGAGATTCTCTGACTTCTGAAGATCACCTCGATGACACATGGGTGACTGTGTTTGGGTTTCCTCAAGCATCTGCTTCCTATATATTATTACAATTTGCACAATATGGGAATATCTTAAAACATGTGATGTCTAACACAGGAAATTGGATGCATATTCGTTATCAATCTAAACTGCAGGCTCGGAAGGCCTTAAGCAAAGATGGGAGGATTTTTGGAGAGTCCATCATGATTGGTGTAAAACCATGTATAGATAAAAGTGTTATGGAAAACAGTGACAGGTGTGCTTTGTCATCCTCACCTCTGGCCTTTACACCACCAATCAAAACCCTAGGTACACCAACCCAATCTGGAAGTACTCCTAGGATTTCTACCATGAGACCTCTTGCTACAGCATACAAAGCTTCTACTAGTGACTATCAGGTCATTTCTGACAGACAAACGCCGAAAAAAGATGAAAGTCTTGTATCCAAAGCAATGGAGTACATGTTCGGCTGGTAGTGTAATAACAGCTAAGAACTGAACTACAAAGGAGGAGGCTGCTACACTAAAACAGTTAGCAGAGTACTGCCAGGTTTCCTTGGGTTAATTATATAACCACTCTCGGCAGTATTGGATAGCTATCTTATACTTTCTTTAGAAGCCTTTTTCTTTAAGGATACAACATATTTGTAGCTCGCACTTTAAAAGATGATTGAGATATGTTTTAAAGAAACAAAAACTCCCTGTAAACAGGATTTTGTGCTTTCTGTAGTAGTGCATGCTTAAGCACAAAAAAACTCAGCATTGATTACTATAAAGTATATAATTGAGTTTGAGATGAAGCTTTGTAGTCTTCTTGAGTTGGTAAGGAGAATTTCATGAAGGGTAACTGTACAGCTGCTTCTAACAAAACACAGTTTATAATTAACAATTTGAATTATGGCCTTTTAATTTAGATAGTATTTAATATTTTAATTATCCTTGTTTTTATATGTCCTATCATGGACTGTCATCTTTCAGTATTCTTAAAAAGCCAG