Transcript asmbl_10797

Sequence
Transcript Sequence for observation asmbl_10797 of TGE0000031:
CTGAAGTCGCCACGGACTCGGGGCAACAGGCAGATTTGCCTGCTGAGGGTGGAGACCCACGAGCCGAGGCCTCCTGCAGTGTTCTGCACAGCAAACCGCACGCTATGGCTGACAGCCGGGATCCCGCCAGCGACCAGATGCAGCACTGGAAGGAGCAGCGGGCCGCGCAGAAAGCTGATGTCCTGACCACTGGAGCTGGTAACCCAGTAGGAGACAAACTTAATGTTATTACAGTAGGGCCCCGTGGGCCCCTTCTTGTTCAGGATGTGGTTTTCACTGATGAAATGGCTCATTTTGACCGAGAGAGAATTCCTGAGAGAGTTGTGCATGCTAAAGGAGCAGGGGCCTTTGGCTACTTTGAGGTCACACATGACATTACCAAATACTCCAAGGCAAAGGTATTTGAGCATATTGGAAAGAAGACTCCCATCGCAGTTCGGTTCTCCACTGTTGCTGGAGAATCGGGTTCAGCTGACACAGTTCGGGACCCTCGTGGGTTTGCAGTGAAATTTTACACAGAAGATGGTAACTGGGATCTCGTTGGAAATAACACCCCCATTTTCTTCATCAGGGATCCCATATTGTTTCCATCTTTTATCCACAGCCAAAAGAGAAATCCTCAGACACATCTGAAGGATCCGGACATGGTCTGGGACTTCTGGAGCCTACGTCCTGAGTCTCTGCATCAGGTTTCTTTCTTGTTCAGTGATCGGGGGATTCCAGATGGACATCGCCACATGAATGGATATGGATCACATACTTTCAAGCTGGTTAATGCAAATGGGGAGGCAGTTTATTGCAAATTCCATTATAAGACTGACCAGGGCATCAAAAACCTTTCTGTTGAAGATGCGGCGAGACTTTCCCAGGAAGATCCTGACTATGGCATCCGGGATCTTTTTAACGCCATTGCCACAGGAAAGTACCCCTCCTGGACTTTTTACATCCAGGTCATGACATTTAATCAGGCAGAAACTTTTCCATTTAATCCATTCGATCTCACCAAGGTTTGGCCTCACAAGGACTACCCTCTCATCCCAGTTGGTAAACTGGTCTTAAACCGGAATCCAGTTAATTACTTTGCTGAGGTTGAACAGATAGCCTTCGACCCAAGCAACATGCCACCTGGCATTGAGGCCAGTCCTGACAAAATGCTTCAGGGCCGCCTTTTTGCCTATCCTGACACTCACCGCCATCGCCTGGGACCCAATTATCTTCATATACCTGTGAACTGTCCCTACCGTGCTCGAGTGGCCAACTACCAGCGTGACGGCCCGATGTGCATGCAGGACAATCAGGGTGGTGCTCCAAATTACTACCCCAACAGCTTTGGTGCTCCGGAACAACAGCCTTCTGCCCTGGAGCACAGCATCCAATATTCTGGAGAAGTGCGGAGATTCAACACTGCCAATGATGATAACGTTACTCAGGTGCGGGCATTCTATGTGAACGTGCTGAATGAGGAACAGAGGAAACGTCTGTGTGAGAACATTGCCGGCCACCTGAAGGATGCACAAATTTTCATCCAGAAGAAAGCGGTCAAGAACTTCACTGAGGTCCACCCTGACTACGGGAGCCACATCCAGGCTCTTCTGGACAAGTACAATGCTGAGAAGCCTAAGAATGCGATTCACACCTTTGTGCAGTCCGGATCTCACTTGGCGGCAAGGGAGAAGGCAAATCTGTGAGGCCGGGGCCCTGCACCTGTGCAGCGAAGCTTAGCGTTCATCCGTGTAACCCGCTCATCACTGGATGAAGATTCTCCTGTGCTAGATGTGCAAATGCAAGCTAGTGGCTTCAAAATAGAGAATCCCACTTTCTATAGCAGATTGTGTAACAATTTTAATGCTATTTCCCCAGGGGAAAATGAAGGTTAGGATTTAACAGTCATTTAAAAAAAAAATTTGTTTTGACGGATGATTGGATTATTCATTTAAAATGATTAGAAGGCAAGTTTCTAGCTAGAAATATGATTTTATTTGACAAAATTTGTTGAAATTATGTATGTTTACATATCACCT