Transcript asmbl_5496

Sequence
Transcript Sequence for observation asmbl_5496 of TGE0006556:
CTGCAGCTGAAGGCTTCCCCTCCGTCAGTGACAGAGCCTTCGGGTGCGTGATCACTTGTGGTTCTGCACCTCGCGCGTTGGCAGGCACTGTTTTCTTTGCCTTCATGAAACTTGCCTTCTGTGGAGTGATACAGACAGTAAACAAGTAAATTAACATGATGGATTTCTCCAAGCTACCCAAAATACTCGATGAAGATAAAGAAAGCACATTTGGTTATGTGCATGGGGTCTCAGGACCTGTCGTTACCGCCTGTGACATGGCAGGTGCAGCTATGTATGAGCTGGTGAGAGTGGGCCACAGCGAGTTAGTTGGAGAGATTATCCGATTGGAGGGGGATATGGCTACTATCCAAGTGTATGAAGAAACCTCTGGTGTGTCTGTCGGAGATCCTGTACTCCGCACTGGTAAACCCCTTTCAGTAGAGCTTGGTCCTGGCATTATGGGAGCCATTTTTGATGGTATTCAAAGACCTTTGTCCGATATCAGCAGTCAGACTCAAAGTATCTACATTCCCCGAGGAGTAAATGTGTCTGCTCTTAGCAGAGATATCAAATGGGATTTTACACCCTGCAAAAATCTACGGGTTGGTAGTCACATCACTGGTGGAGATATTTATGGAATTGTCAATGAGAATTCTCTCATCAGACACAAAATCATGTTACCCCCACGAAACAGAGGAACCGTAACTTATATTGCTCCACCTGGAAATTACGATACCTCTGATGTTGTCTTGGAACTTGAATTTGAAGGTATAAAGGAGAAGTTCAGCATGGTCCAAATATGGCCTGTACGTCAAGTTCGGCCTGTCACTGAGAAGCTGCCGGCTAATCATCCTTTGTTGACTGGCCAGAGAGTCCTCGATGCCCTTTTTCCATGTGTACAGGGAGGAACTACTGCAATCCCTGGGGCTTTTGGATGTGGAAAGACGGTGATATCACAGTCTCTATCCAAGTATTCCAATAGTGATGTAATCATCTATGTAGGATGTGGTGAAAGAGGAAATGAGATGTCTGAAGTCCTTCGTGATTTCCCAGAGCTCACTATGGAAGTTGATGGTAAGGTAGAGTCAATTATGAAGAGGACAGCTTTGGTAGCCAATACCTCCAACATGCCTGTGGCTGCCAGAGAAGCCTCCATTTATACTGGAATTACACTGTCAGAATATTTCCGTGACATGGGCTATAATGTTAGTATGATGGCTGACTCAACCTCTAGATGGGCTGAGGCCCTGAGAGAAATCTCTGGTCGCTTAGCTGAAATGCCTGCAGATAGTGGATATCCTGCATATCTTGGTGCCCGTCTGGCCTCTTTCTATGAGCGAGCAGGCAGGGTGAAATGTCTTGGAAATCCTGAAAGAGAAGGGAGTGTCAGCATTGTAGGAGCAGTTTCTCCACCTGGTGGTGATTTTTCTGACCCAGTTACATCTGCTACTCTTGGTATTGTTCAGGTATTCTGGGGCTTAGATAAGAAACTAGCCCAACGTAAGCATTTCCCCTCTGTTAATTGGCTAATCAGCTACAGCAAGTATATGCGTGCCTTGGATGAGTACTATGACAAACACTTCACAGAATTTGTTCCTCTGAGGACCAAGGCTAAGGAGATTCTGCAGGAAGAGGAAGACCTGGCAGAAATTGTGCAGCTTGTGGGAAAGGCTTCTCTAGCAGAAACAGATAAAATCACTCTGGAGGTAGCCAAACTTATCAAAGATGATTTCCTACAACAAAATGGATATACTCCTTATGACAGGTTCTGCCCATTCTACAAGACAGTAGGGATGCTGTCCAACATGATTGCATTTTATGATATGGCCCGTAGAGCTGTTGAAACCACTGCCCAGAGTGACAATAAAATCACATGGGCCATTATCCGTGAGCACATGGGGGAGATCCTCTATAAACTTTCCTCCATGAAATTCAAGGATCCATTGAAAGATGGTGAGGCAAAGATCAAAGCAGACTATGCACAACTTCTTGAAGATATGCAGAATGCATTCCGTAGCCTTGAAGATTAGAACTGTGATTTCTTTCTTCCTTTTCCTCAGCAAGTTCTCATGTGTGTATATTTTCCTAGATCTCATCTCAGACCCTTTGCTTTTTTATTGTGCAGCTTTGAGATTCGTGCCTATATGTGTTATCATTTCTTTTCCGGTTTATTTGGTAGGTCTTATATAAAGCAAACATTCCTTTGTTCCAGTGTTTGAAGGGCCTCCTTGATCCTTTCTCCAAAGTGGTGAATGTAGTAAATATGATATACTCTGGCTACACTACTGTAAACTTGTGTGTAGAGTCATGTCCCTCCTTGTCCTAGGTTTGCCCTTTCCTTATCGCCATTACATTGTAAACAGGACTACTGCATGTACTTTGCAACAGATTTGGAATGAAAGGCCAGATTTCTATACATTTTGCCAGGTACTTTATAAAGTGACTTGATATCTATCTACATGTCAAGGTTATTTGCAGTTTAGCATTTTACTAAGTAACTGCTTTGCAGGAAATGTTTGCTTTTTTAAAAAAGATGAATGATTAACGTTCCAATTATGCATTGCTTCCCCACTATATATCAGGAATATTTATGGGAAACTGTTGGGGACTATACTGTTTTTAAAAGTCTTTTGTGGGGACTCAGCACAATATATGAATCAGTACCCTCTAAAAAAGTAAAAAAAAGGGGTCAGATGGTCAAATTTAGATTAATGTCATCTTGTTAAACCTTATTTTGTTTCACTAGGAAAATTTCAGTATCAAGGAATAGTCTACCGCATTACTAGGAAATTCTCTTTTAAATTACATTTAGAACAATCACTGAAAACTTAATCCACATCATATCCTTTTCCTTAAACATCTTAGAAGCTTAAGCTTCTAAGAATCATGTGGCAGCGTGATGGGCAATAAAATGTCACAAAGAAGATATTTATTAATGGTTAAAGGCTCTTTGCACCTTTAAGGACCAGCTGAGCTGTACTGATTCTTGGGGCCAGAGTGGCATTATGTTTTTACAAAATGACATGTGTCACATGTTTGCATGTTTGTTCACTTATTGAATTTTTGAACAAGCAGTTTACCAATTGTAGACGTAATATTTTCTTTCATGTGGGTTTTGATTCACTGGCTCAAGAGTTCTCAGAATATCTGTAGCCATAGCAGCTTACCAGTTTCCATTTGGTTTAATAGGGATAAATTAATTTTTGTGTCTGCTGATGGCAGAATCTAGGTCATGTGAAGAAAGATTATTTCGTCCTATCTTTGAAGTATATATTTTAAAATAGTAGTTTCAGTGTTTGTACAATAAGGTACACTGCAGAACAGCTTTGAGAGCAACAGTTTCCCATTAACT